\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121327044:

Variant ID: vg1121327044 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21327044
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:


CTAATGAGATTCTTGATTTCTCGCAAGAATTGTATACAATCTATGATTAATTAAATTCTATATCCTTCTTGATTCTATGCAGTCTGACTTCGATTGGGTT[G/A]
AGCACTCAGCTTGGCGTGCTTCTCTATTCTCCCTTGCATGGCGGAGATCATGTTTGTGATGGTCAATCGATTTGGTAACATCGGCAAGAAACTGTGATTT

Reverse complement sequence

AAATCACAGTTTCTTGCCGATGTTACCAAATCGATTGACCATCACAAACATGATCTCCGCCATGCAAGGGAGAATAGAGAAGCACGCCAAGCTGAGTGCT[C/T]
AACCCAATCGAAGTCAGACTGCATAGAATCAAGAAGGATATAGAATTTAATTAATCATAGATTGTATACAATTCTTGCGAGAAATCAAGAATCTCATTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.60% 4.20% 0.28% 0.00% NA
All Indica  2759 99.20% 0.70% 0.07% 0.00% NA
All Japonica  1512 90.30% 9.10% 0.60% 0.00% NA
Aus  269 87.70% 11.90% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 99.70% 0.20% 0.11% 0.00% NA
Indica Intermediate  786 97.70% 2.30% 0.00% 0.00% NA
Temperate Japonica  767 97.40% 2.30% 0.26% 0.00% NA
Tropical Japonica  504 79.20% 19.40% 1.39% 0.00% NA
Japonica Intermediate  241 91.30% 8.70% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 92.20% 6.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121327044 G -> A LOC_Os11g36230.1 upstream_gene_variant ; 2067.0bp to feature; MODIFIER silent_mutation Average:60.504; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg1121327044 G -> A LOC_Os11g36230-LOC_Os11g36240 intergenic_region ; MODIFIER silent_mutation Average:60.504; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121327044 1.69E-11 NA mr1055_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121327044 1.11E-08 NA mr1055_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121327044 2.46E-06 NA mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121327044 1.63E-06 NA mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251