Variant ID: vg1121327044 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 21327044 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 327. )
CTAATGAGATTCTTGATTTCTCGCAAGAATTGTATACAATCTATGATTAATTAAATTCTATATCCTTCTTGATTCTATGCAGTCTGACTTCGATTGGGTT[G/A]
AGCACTCAGCTTGGCGTGCTTCTCTATTCTCCCTTGCATGGCGGAGATCATGTTTGTGATGGTCAATCGATTTGGTAACATCGGCAAGAAACTGTGATTT
AAATCACAGTTTCTTGCCGATGTTACCAAATCGATTGACCATCACAAACATGATCTCCGCCATGCAAGGGAGAATAGAGAAGCACGCCAAGCTGAGTGCT[C/T]
AACCCAATCGAAGTCAGACTGCATAGAATCAAGAAGGATATAGAATTTAATTAATCATAGATTGTATACAATTCTTGCGAGAAATCAAGAATCTCATTAG
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 95.60% | 4.20% | 0.28% | 0.00% | NA |
All Indica | 2759 | 99.20% | 0.70% | 0.07% | 0.00% | NA |
All Japonica | 1512 | 90.30% | 9.10% | 0.60% | 0.00% | NA |
Aus | 269 | 87.70% | 11.90% | 0.37% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
Indica III | 913 | 99.70% | 0.20% | 0.11% | 0.00% | NA |
Indica Intermediate | 786 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 97.40% | 2.30% | 0.26% | 0.00% | NA |
Tropical Japonica | 504 | 79.20% | 19.40% | 1.39% | 0.00% | NA |
Japonica Intermediate | 241 | 91.30% | 8.70% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
Intermediate | 90 | 92.20% | 6.70% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1121327044 | G -> A | LOC_Os11g36230.1 | upstream_gene_variant ; 2067.0bp to feature; MODIFIER | silent_mutation | Average:60.504; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
vg1121327044 | G -> A | LOC_Os11g36230-LOC_Os11g36240 | intergenic_region ; MODIFIER | silent_mutation | Average:60.504; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1121327044 | 1.69E-11 | NA | mr1055_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1121327044 | 1.11E-08 | NA | mr1055_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1121327044 | 2.46E-06 | NA | mr1390_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1121327044 | 1.63E-06 | NA | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |