\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121306839:

Variant ID: vg1121306839 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21306839
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 368. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGTTCAGGACTAAACTGAGCACCGAGTTAAGCCTTACCCATTAGACATGTGGTTAGTACGGTAGTGCTTTGCAACAGAGGCCCGAAGACCGGTCCTTA[C/T]
AGTGGCCGAGGTGCTACTAGCAAAACCCTGTACCTCGAGCCCAGCCTAAAACCATTTTGGGAGTTTTGAATAGAGGGGGGGGGAGGTGTGTGTTCAATTC

Reverse complement sequence

GAATTGAACACACACCTCCCCCCCCCTCTATTCAAAACTCCCAAAATGGTTTTAGGCTGGGCTCGAGGTACAGGGTTTTGCTAGTAGCACCTCGGCCACT[G/A]
TAAGGACCGGTCTTCGGGCCTCTGTTGCAAAGCACTACCGTACTAACCACATGTCTAATGGGTAAGGCTTAACTCGGTGCTCAGTTTAGTCCTGAACAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.10% 26.10% 14.64% 0.11% NA
All Indica  2759 80.30% 7.90% 11.67% 0.14% NA
All Japonica  1512 26.50% 64.10% 9.33% 0.07% NA
Aus  269 34.20% 7.10% 58.74% 0.00% NA
Indica I  595 43.70% 23.40% 32.44% 0.50% NA
Indica II  465 92.00% 4.50% 3.23% 0.22% NA
Indica III  913 93.20% 1.30% 5.48% 0.00% NA
Indica Intermediate  786 86.10% 5.70% 8.14% 0.00% NA
Temperate Japonica  767 18.30% 78.40% 3.39% 0.00% NA
Tropical Japonica  504 27.60% 52.40% 20.04% 0.00% NA
Japonica Intermediate  241 50.60% 43.20% 5.81% 0.41% NA
VI/Aromatic  96 37.50% 5.20% 57.29% 0.00% NA
Intermediate  90 54.40% 27.80% 17.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121306839 C -> T LOC_Os11g36210.1 upstream_gene_variant ; 1594.0bp to feature; MODIFIER silent_mutation Average:69.933; most accessible tissue: Minghui63 flag leaf, score: 94.399 N N N N
vg1121306839 C -> T LOC_Os11g36220.1 downstream_gene_variant ; 4016.0bp to feature; MODIFIER silent_mutation Average:69.933; most accessible tissue: Minghui63 flag leaf, score: 94.399 N N N N
vg1121306839 C -> T LOC_Os11g36200-LOC_Os11g36210 intergenic_region ; MODIFIER silent_mutation Average:69.933; most accessible tissue: Minghui63 flag leaf, score: 94.399 N N N N
vg1121306839 C -> DEL N N silent_mutation Average:69.933; most accessible tissue: Minghui63 flag leaf, score: 94.399 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1121306839 C T -0.02 -0.02 -0.02 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121306839 NA 4.61E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121306839 7.02E-06 NA mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121306839 1.21E-10 NA mr1055_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121306839 2.92E-07 NA mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121306839 6.76E-06 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121306839 1.78E-06 NA mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251