\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121250679:

Variant ID: vg1121250679 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21250679
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTTGCTAGTTTATTTCTCGTATGGTGTACAAAATTTAGAAAAAAAATAAACTAAAAGTGGGTTAAGTATAAACTACAAGTCGAATAAGCGAAAAAAAAA[C/A]
CCGGGCAAATGCATCCCTGGTCACCGGACGCCTCCGGTCTACGTGTAAGGAGGGACTTACACGTTGGTCCCACGGTTCAGTCTCAGTGATACGCTCGCCT

Reverse complement sequence

AGGCGAGCGTATCACTGAGACTGAACCGTGGGACCAACGTGTAAGTCCCTCCTTACACGTAGACCGGAGGCGTCCGGTGACCAGGGATGCATTTGCCCGG[G/T]
TTTTTTTTTCGCTTATTCGACTTGTAGTTTATACTTAACCCACTTTTAGTTTATTTTTTTTCTAAATTTTGTACACCATACGAGAAATAAACTAGCAAGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.90% 19.20% 9.37% 13.46% NA
All Indica  2759 54.30% 12.90% 14.03% 18.74% NA
All Japonica  1512 64.70% 32.20% 1.98% 1.06% NA
Aus  269 71.40% 10.80% 6.32% 11.52% NA
Indica I  595 67.40% 1.50% 10.42% 20.67% NA
Indica II  465 45.60% 3.90% 20.65% 29.89% NA
Indica III  913 54.20% 27.80% 9.20% 8.76% NA
Indica Intermediate  786 49.70% 9.50% 18.45% 22.26% NA
Temperate Japonica  767 77.70% 19.00% 2.09% 1.17% NA
Tropical Japonica  504 54.40% 43.10% 2.38% 0.20% NA
Japonica Intermediate  241 45.20% 51.50% 0.83% 2.49% NA
VI/Aromatic  96 19.80% 20.80% 1.04% 58.33% NA
Intermediate  90 54.40% 18.90% 8.89% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121250679 C -> A LOC_Os11g36140.1 upstream_gene_variant ; 3864.0bp to feature; MODIFIER silent_mutation Average:83.624; most accessible tissue: Zhenshan97 young leaf, score: 94.955 N N N N
vg1121250679 C -> A LOC_Os11g36150.1 downstream_gene_variant ; 176.0bp to feature; MODIFIER silent_mutation Average:83.624; most accessible tissue: Zhenshan97 young leaf, score: 94.955 N N N N
vg1121250679 C -> A LOC_Os11g36140-LOC_Os11g36150 intergenic_region ; MODIFIER silent_mutation Average:83.624; most accessible tissue: Zhenshan97 young leaf, score: 94.955 N N N N
vg1121250679 C -> DEL N N silent_mutation Average:83.624; most accessible tissue: Zhenshan97 young leaf, score: 94.955 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1121250679 C A 0.09 0.01 0.0 -0.03 0.0 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121250679 NA 4.12E-07 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250679 NA 1.44E-08 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250679 NA 5.16E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250679 NA 6.52E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250679 NA 5.12E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250679 9.97E-07 9.91E-07 mr1497 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250679 NA 4.80E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250679 NA 5.46E-06 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250679 NA 2.34E-07 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250679 NA 1.86E-06 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250679 2.23E-06 NA mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250679 NA 2.34E-06 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250679 NA 1.28E-06 mr1809 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250679 NA 2.06E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250679 NA 3.23E-07 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250679 NA 2.96E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250679 NA 8.29E-08 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251