\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121249384:

Variant ID: vg1121249384 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21249384
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGATCGACTGACTACTAGCCCTGTAATTCTTTCTTATCTGACCGTGTTGGACACGCATATGGACACATTGCACGTACGGTTATCCCGAGCAATTTTACC[G/A]
TTTAACATTTTATACCTCGTGGTACCACTAATTTTTTTTACCTCAAGATACTTTCTAGTATAAAATTTAGTACATGAGGTAGTATTATATAATAGGCACT

Reverse complement sequence

AGTGCCTATTATATAATACTACCTCATGTACTAAATTTTATACTAGAAAGTATCTTGAGGTAAAAAAAATTAGTGGTACCACGAGGTATAAAATGTTAAA[C/T]
GGTAAAATTGCTCGGGATAACCGTACGTGCAATGTGTCCATATGCGTGTCCAACACGGTCAGATAAGAAAGAATTACAGGGCTAGTAGTCAGTCGATCGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.10% 40.50% 3.05% 4.40% NA
All Indica  2759 74.00% 18.00% 3.23% 4.78% NA
All Japonica  1512 10.80% 83.70% 2.98% 2.51% NA
Aus  269 75.10% 13.40% 0.37% 11.15% NA
Indica I  595 74.10% 18.70% 3.70% 3.53% NA
Indica II  465 84.70% 5.80% 3.87% 5.59% NA
Indica III  913 65.10% 28.70% 1.86% 4.38% NA
Indica Intermediate  786 78.00% 12.20% 4.07% 5.73% NA
Temperate Japonica  767 9.00% 90.20% 0.39% 0.39% NA
Tropical Japonica  504 15.70% 71.00% 7.34% 5.95% NA
Japonica Intermediate  241 6.60% 89.20% 2.07% 2.07% NA
VI/Aromatic  96 16.70% 77.10% 3.12% 3.12% NA
Intermediate  90 40.00% 47.80% 6.67% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121249384 G -> A LOC_Os11g36140.1 upstream_gene_variant ; 2569.0bp to feature; MODIFIER silent_mutation Average:83.097; most accessible tissue: Zhenshan97 young leaf, score: 90.638 N N N N
vg1121249384 G -> A LOC_Os11g36150.1 downstream_gene_variant ; 1471.0bp to feature; MODIFIER silent_mutation Average:83.097; most accessible tissue: Zhenshan97 young leaf, score: 90.638 N N N N
vg1121249384 G -> A LOC_Os11g36140-LOC_Os11g36150 intergenic_region ; MODIFIER silent_mutation Average:83.097; most accessible tissue: Zhenshan97 young leaf, score: 90.638 N N N N
vg1121249384 G -> DEL N N silent_mutation Average:83.097; most accessible tissue: Zhenshan97 young leaf, score: 90.638 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1121249384 G A -0.02 0.03 0.01 -0.01 0.0 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121249384 NA 1.82E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121249384 NA 6.25E-06 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121249384 1.42E-06 6.20E-10 mr1973 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121249384 NA 1.92E-07 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251