\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121210363:

Variant ID: vg1121210363 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21210363
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, T: 0.18, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


TAAATTTATCTTGGGTTGAAAATATTACTACTTTTCTCTACAAACCTGGTGAAACTTAAAACAGTTTGACTTTGATTAAAGTCAAAACGTCTTATAACCT[T/G]
AACGGAGGGAGTATCATGCAGACTGTAACCAGAAATGAACAAGGGAATATTCATTTTGCATAGTACTCTTGTATAAATTATCAAAGGTATCATGCAGACT

Reverse complement sequence

AGTCTGCATGATACCTTTGATAATTTATACAAGAGTACTATGCAAAATGAATATTCCCTTGTTCATTTCTGGTTACAGTCTGCATGATACTCCCTCCGTT[A/C]
AGGTTATAAGACGTTTTGACTTTAATCAAAGTCAAACTGTTTTAAGTTTCACCAGGTTTGTAGAGAAAAGTAGTAATATTTTCAACCCAAGATAAATTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.20% 35.80% 0.23% 0.74% NA
All Indica  2759 63.00% 36.50% 0.22% 0.29% NA
All Japonica  1512 56.60% 43.10% 0.20% 0.07% NA
Aus  269 89.20% 1.50% 0.37% 8.92% NA
Indica I  595 69.20% 30.80% 0.00% 0.00% NA
Indica II  465 68.80% 31.00% 0.22% 0.00% NA
Indica III  913 58.60% 40.70% 0.11% 0.55% NA
Indica Intermediate  786 59.90% 39.20% 0.51% 0.38% NA
Temperate Japonica  767 22.80% 76.80% 0.39% 0.00% NA
Tropical Japonica  504 97.20% 2.80% 0.00% 0.00% NA
Japonica Intermediate  241 79.30% 20.30% 0.00% 0.41% NA
VI/Aromatic  96 96.90% 2.10% 0.00% 1.04% NA
Intermediate  90 67.80% 30.00% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121210363 T -> DEL N N silent_mutation Average:43.933; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg1121210363 T -> G LOC_Os11g36070.1 downstream_gene_variant ; 3036.0bp to feature; MODIFIER silent_mutation Average:43.933; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg1121210363 T -> G LOC_Os11g36090.1 downstream_gene_variant ; 348.0bp to feature; MODIFIER silent_mutation Average:43.933; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg1121210363 T -> G LOC_Os11g36070.4 downstream_gene_variant ; 3036.0bp to feature; MODIFIER silent_mutation Average:43.933; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg1121210363 T -> G LOC_Os11g36070.3 downstream_gene_variant ; 3036.0bp to feature; MODIFIER silent_mutation Average:43.933; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg1121210363 T -> G LOC_Os11g36070.2 downstream_gene_variant ; 3036.0bp to feature; MODIFIER silent_mutation Average:43.933; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg1121210363 T -> G LOC_Os11g36070-LOC_Os11g36090 intergenic_region ; MODIFIER silent_mutation Average:43.933; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121210363 NA 5.36E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121210363 3.16E-06 NA mr1056 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121210363 NA 1.97E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121210363 NA 4.21E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121210363 NA 2.36E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121210363 NA 1.11E-11 mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121210363 NA 6.47E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121210363 NA 2.98E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121210363 NA 1.18E-06 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121210363 NA 3.50E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121210363 NA 5.11E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251