\
| Variant ID: vg1121210363 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 21210363 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, T: 0.18, others allele: 0.00, population size: 100. )
TAAATTTATCTTGGGTTGAAAATATTACTACTTTTCTCTACAAACCTGGTGAAACTTAAAACAGTTTGACTTTGATTAAAGTCAAAACGTCTTATAACCT[T/G]
AACGGAGGGAGTATCATGCAGACTGTAACCAGAAATGAACAAGGGAATATTCATTTTGCATAGTACTCTTGTATAAATTATCAAAGGTATCATGCAGACT
AGTCTGCATGATACCTTTGATAATTTATACAAGAGTACTATGCAAAATGAATATTCCCTTGTTCATTTCTGGTTACAGTCTGCATGATACTCCCTCCGTT[A/C]
AGGTTATAAGACGTTTTGACTTTAATCAAAGTCAAACTGTTTTAAGTTTCACCAGGTTTGTAGAGAAAAGTAGTAATATTTTCAACCCAAGATAAATTTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.20% | 35.80% | 0.23% | 0.74% | NA |
| All Indica | 2759 | 63.00% | 36.50% | 0.22% | 0.29% | NA |
| All Japonica | 1512 | 56.60% | 43.10% | 0.20% | 0.07% | NA |
| Aus | 269 | 89.20% | 1.50% | 0.37% | 8.92% | NA |
| Indica I | 595 | 69.20% | 30.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 68.80% | 31.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 58.60% | 40.70% | 0.11% | 0.55% | NA |
| Indica Intermediate | 786 | 59.90% | 39.20% | 0.51% | 0.38% | NA |
| Temperate Japonica | 767 | 22.80% | 76.80% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 79.30% | 20.30% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 96.90% | 2.10% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 67.80% | 30.00% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1121210363 | T -> DEL | N | N | silent_mutation | Average:43.933; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg1121210363 | T -> G | LOC_Os11g36070.1 | downstream_gene_variant ; 3036.0bp to feature; MODIFIER | silent_mutation | Average:43.933; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg1121210363 | T -> G | LOC_Os11g36090.1 | downstream_gene_variant ; 348.0bp to feature; MODIFIER | silent_mutation | Average:43.933; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg1121210363 | T -> G | LOC_Os11g36070.4 | downstream_gene_variant ; 3036.0bp to feature; MODIFIER | silent_mutation | Average:43.933; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg1121210363 | T -> G | LOC_Os11g36070.3 | downstream_gene_variant ; 3036.0bp to feature; MODIFIER | silent_mutation | Average:43.933; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg1121210363 | T -> G | LOC_Os11g36070.2 | downstream_gene_variant ; 3036.0bp to feature; MODIFIER | silent_mutation | Average:43.933; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg1121210363 | T -> G | LOC_Os11g36070-LOC_Os11g36090 | intergenic_region ; MODIFIER | silent_mutation | Average:43.933; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1121210363 | NA | 5.36E-07 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121210363 | 3.16E-06 | NA | mr1056 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121210363 | NA | 1.97E-06 | mr1056 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121210363 | NA | 4.21E-06 | mr1576 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121210363 | NA | 2.36E-07 | mr1729 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121210363 | NA | 1.11E-11 | mr1879 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121210363 | NA | 6.47E-07 | mr1042_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121210363 | NA | 2.98E-07 | mr1229_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121210363 | NA | 1.18E-06 | mr1693_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121210363 | NA | 3.50E-09 | mr1742_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121210363 | NA | 5.11E-08 | mr1880_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |