Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121209742:

Variant ID: vg1121209742 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 21209742
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, G: 0.10, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

GATGGCGCCCCGCGATGCCGCTACTTCTTATGGTTGGTTGCTCTCAACAGGTGCTGGATCGTGGACCTCCTCCACAACCGTGGCCTCCCACACCTAGACC[G/A]
TTGCGTCATTTGTGATCAACACGAAGAGAGCATAGAACGTGGCTAGAGGTTGCGAAGGCAATGATTGCTGAAGCGGAACTCTGGCGTTTGGCCAACGCGG

Reverse complement sequence

CCGCGTTGGCCAAACGCCAGAGTTCCGCTTCAGCAATCATTGCCTTCGCAACCTCTAGCCACGTTCTATGCTCTCTTCGTGTTGATCACAAATGACGCAA[C/T]
GGTCTAGGTGTGGGAGGCCACGGTTGTGGAGGAGGTCCACGATCCAGCACCTGTTGAGAGCAACCAACCATAAGAAGTAGCGGCATCGCGGGGCGCCATC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.20%	40.80%	0.30%	0.74%	NA
All Indica	2759	59.00%	40.40%	0.29%	0.29%	NA
All Japonica	1512	51.90%	47.80%	0.20%	0.07%	NA
Aus	269	70.30%	20.80%	0.00%	8.92%	NA
Indica I	595	32.60%	67.40%	0.00%	0.00%	NA
Indica II	465	68.20%	31.20%	0.65%	0.00%	NA
Indica III	913	67.60%	31.70%	0.22%	0.55%	NA
Indica Intermediate	786	63.70%	35.50%	0.38%	0.38%	NA
Temperate Japonica	767	21.40%	78.50%	0.13%	0.00%	NA
Tropical Japonica	504	86.30%	13.30%	0.40%	0.00%	NA
Japonica Intermediate	241	77.20%	22.40%	0.00%	0.41%	NA
VI/Aromatic	96	96.90%	2.10%	0.00%	1.04%	NA
Intermediate	90	58.90%	36.70%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1121209742	G -> A	LOC_Os11g36070.1	downstream_gene_variant ; 2415.0bp to feature; MODIFIER	silent_mutation	Average:68.191; most accessible tissue: Zhenshan97 young leaf, score: 87.004	N	N	N	N
vg1121209742	G -> A	LOC_Os11g36090.1	downstream_gene_variant ; 969.0bp to feature; MODIFIER	silent_mutation	Average:68.191; most accessible tissue: Zhenshan97 young leaf, score: 87.004	N	N	N	N
vg1121209742	G -> A	LOC_Os11g36070.4	downstream_gene_variant ; 2415.0bp to feature; MODIFIER	silent_mutation	Average:68.191; most accessible tissue: Zhenshan97 young leaf, score: 87.004	N	N	N	N
vg1121209742	G -> A	LOC_Os11g36070.3	downstream_gene_variant ; 2415.0bp to feature; MODIFIER	silent_mutation	Average:68.191; most accessible tissue: Zhenshan97 young leaf, score: 87.004	N	N	N	N
vg1121209742	G -> A	LOC_Os11g36070.2	downstream_gene_variant ; 2415.0bp to feature; MODIFIER	silent_mutation	Average:68.191; most accessible tissue: Zhenshan97 young leaf, score: 87.004	N	N	N	N
vg1121209742	G -> A	LOC_Os11g36070-LOC_Os11g36090	intergenic_region ; MODIFIER	silent_mutation	Average:68.191; most accessible tissue: Zhenshan97 young leaf, score: 87.004	N	N	N	N
vg1121209742	G -> DEL	N	N	silent_mutation	Average:68.191; most accessible tissue: Zhenshan97 young leaf, score: 87.004	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1121209742	NA	5.93E-06	mr1013	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121209742	NA	3.43E-06	mr1034	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121209742	NA	3.88E-07	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121209742	NA	1.16E-06	mr1324	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121209742	NA	7.56E-09	mr1502	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121209742	NA	5.20E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121209742	NA	1.61E-07	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121209742	1.73E-06	NA	mr1580	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121209742	NA	1.01E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121209742	NA	5.24E-06	mr1808	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121209742	NA	2.06E-12	mr1879	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121209742	NA	3.45E-06	mr1892	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121209742	8.67E-06	8.66E-06	mr1966	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121209742	NA	3.81E-06	mr1986	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121209742	NA	6.33E-07	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121209742	NA	5.75E-07	mr1274_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251