Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1121160624:

Variant ID: vg1121160624 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 21160624
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.64, C: 0.36, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:

GTCAAGGCATGTATCAAACCTGGACTATGATTACCATACAATTAAAAAAATAACAACCATAACTAAAAAAACTACCATTTTATATTTATACATGTACATA[G/C]
ATAGTCCAATCTATCTATTATATACTAAAAGTTCATTAAACTTTCTAAAAATACTCTCAAGACACCACATGGCTTACTACAAACGCTCCTAAGTCACCAC

Reverse complement sequence

GTGGTGACTTAGGAGCGTTTGTAGTAAGCCATGTGGTGTCTTGAGAGTATTTTTAGAAAGTTTAATGAACTTTTAGTATATAATAGATAGATTGGACTAT[C/G]
TATGTACATGTATAAATATAAAATGGTAGTTTTTTTAGTTATGGTTGTTATTTTTTTAATTGTATGGTAATCATAGTCCAGGTTTGATACATGCCTTGAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.50%	37.10%	0.47%	10.03%	NA
All Indica	2759	34.10%	49.70%	0.76%	15.44%	NA
All Japonica	1512	91.40%	7.80%	0.00%	0.79%	NA
Aus	269	40.10%	50.60%	0.37%	8.92%	NA
Indica I	595	60.70%	35.10%	0.67%	3.53%	NA
Indica II	465	11.40%	67.10%	0.65%	20.86%	NA
Indica III	913	33.00%	47.10%	0.66%	19.28%	NA
Indica Intermediate	786	28.80%	53.40%	1.02%	16.79%	NA
Temperate Japonica	767	95.30%	3.70%	0.00%	1.04%	NA
Tropical Japonica	504	83.10%	16.50%	0.00%	0.40%	NA
Japonica Intermediate	241	96.30%	2.90%	0.00%	0.83%	NA
VI/Aromatic	96	8.30%	88.50%	0.00%	3.12%	NA
Intermediate	90	44.40%	45.60%	0.00%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1121160624	G -> DEL	N	N	silent_mutation	Average:27.828; most accessible tissue: Zhenshan97 young leaf, score: 51.334	N	N	N	N
vg1121160624	G -> C	LOC_Os11g36005.1	upstream_gene_variant ; 630.0bp to feature; MODIFIER	silent_mutation	Average:27.828; most accessible tissue: Zhenshan97 young leaf, score: 51.334	N	N	N	N
vg1121160624	G -> C	LOC_Os11g36010.1	upstream_gene_variant ; 2330.0bp to feature; MODIFIER	silent_mutation	Average:27.828; most accessible tissue: Zhenshan97 young leaf, score: 51.334	N	N	N	N
vg1121160624	G -> C	LOC_Os11g36000.1	downstream_gene_variant ; 1562.0bp to feature; MODIFIER	silent_mutation	Average:27.828; most accessible tissue: Zhenshan97 young leaf, score: 51.334	N	N	N	N
vg1121160624	G -> C	LOC_Os11g36000-LOC_Os11g36005	intergenic_region ; MODIFIER	silent_mutation	Average:27.828; most accessible tissue: Zhenshan97 young leaf, score: 51.334	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1121160624	NA	6.82E-06	mr1021	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121160624	NA	5.32E-06	mr1032	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121160624	NA	5.91E-06	mr1165	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121160624	NA	1.03E-06	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121160624	NA	2.66E-06	mr1478	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121160624	NA	2.15E-06	mr1971	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251