\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121160624:

Variant ID: vg1121160624 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21160624
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.64, C: 0.36, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


GTCAAGGCATGTATCAAACCTGGACTATGATTACCATACAATTAAAAAAATAACAACCATAACTAAAAAAACTACCATTTTATATTTATACATGTACATA[G/C]
ATAGTCCAATCTATCTATTATATACTAAAAGTTCATTAAACTTTCTAAAAATACTCTCAAGACACCACATGGCTTACTACAAACGCTCCTAAGTCACCAC

Reverse complement sequence

GTGGTGACTTAGGAGCGTTTGTAGTAAGCCATGTGGTGTCTTGAGAGTATTTTTAGAAAGTTTAATGAACTTTTAGTATATAATAGATAGATTGGACTAT[C/G]
TATGTACATGTATAAATATAAAATGGTAGTTTTTTTAGTTATGGTTGTTATTTTTTTAATTGTATGGTAATCATAGTCCAGGTTTGATACATGCCTTGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.50% 37.10% 0.47% 10.03% NA
All Indica  2759 34.10% 49.70% 0.76% 15.44% NA
All Japonica  1512 91.40% 7.80% 0.00% 0.79% NA
Aus  269 40.10% 50.60% 0.37% 8.92% NA
Indica I  595 60.70% 35.10% 0.67% 3.53% NA
Indica II  465 11.40% 67.10% 0.65% 20.86% NA
Indica III  913 33.00% 47.10% 0.66% 19.28% NA
Indica Intermediate  786 28.80% 53.40% 1.02% 16.79% NA
Temperate Japonica  767 95.30% 3.70% 0.00% 1.04% NA
Tropical Japonica  504 83.10% 16.50% 0.00% 0.40% NA
Japonica Intermediate  241 96.30% 2.90% 0.00% 0.83% NA
VI/Aromatic  96 8.30% 88.50% 0.00% 3.12% NA
Intermediate  90 44.40% 45.60% 0.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121160624 G -> DEL N N silent_mutation Average:27.828; most accessible tissue: Zhenshan97 young leaf, score: 51.334 N N N N
vg1121160624 G -> C LOC_Os11g36005.1 upstream_gene_variant ; 630.0bp to feature; MODIFIER silent_mutation Average:27.828; most accessible tissue: Zhenshan97 young leaf, score: 51.334 N N N N
vg1121160624 G -> C LOC_Os11g36010.1 upstream_gene_variant ; 2330.0bp to feature; MODIFIER silent_mutation Average:27.828; most accessible tissue: Zhenshan97 young leaf, score: 51.334 N N N N
vg1121160624 G -> C LOC_Os11g36000.1 downstream_gene_variant ; 1562.0bp to feature; MODIFIER silent_mutation Average:27.828; most accessible tissue: Zhenshan97 young leaf, score: 51.334 N N N N
vg1121160624 G -> C LOC_Os11g36000-LOC_Os11g36005 intergenic_region ; MODIFIER silent_mutation Average:27.828; most accessible tissue: Zhenshan97 young leaf, score: 51.334 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121160624 NA 6.82E-06 mr1021 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121160624 NA 5.32E-06 mr1032 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121160624 NA 5.91E-06 mr1165 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121160624 NA 1.03E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121160624 NA 2.66E-06 mr1478 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121160624 NA 2.15E-06 mr1971 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251