\
| Variant ID: vg1121160624 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 21160624 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.64, C: 0.36, others allele: 0.00, population size: 77. )
GTCAAGGCATGTATCAAACCTGGACTATGATTACCATACAATTAAAAAAATAACAACCATAACTAAAAAAACTACCATTTTATATTTATACATGTACATA[G/C]
ATAGTCCAATCTATCTATTATATACTAAAAGTTCATTAAACTTTCTAAAAATACTCTCAAGACACCACATGGCTTACTACAAACGCTCCTAAGTCACCAC
GTGGTGACTTAGGAGCGTTTGTAGTAAGCCATGTGGTGTCTTGAGAGTATTTTTAGAAAGTTTAATGAACTTTTAGTATATAATAGATAGATTGGACTAT[C/G]
TATGTACATGTATAAATATAAAATGGTAGTTTTTTTAGTTATGGTTGTTATTTTTTTAATTGTATGGTAATCATAGTCCAGGTTTGATACATGCCTTGAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.50% | 37.10% | 0.47% | 10.03% | NA |
| All Indica | 2759 | 34.10% | 49.70% | 0.76% | 15.44% | NA |
| All Japonica | 1512 | 91.40% | 7.80% | 0.00% | 0.79% | NA |
| Aus | 269 | 40.10% | 50.60% | 0.37% | 8.92% | NA |
| Indica I | 595 | 60.70% | 35.10% | 0.67% | 3.53% | NA |
| Indica II | 465 | 11.40% | 67.10% | 0.65% | 20.86% | NA |
| Indica III | 913 | 33.00% | 47.10% | 0.66% | 19.28% | NA |
| Indica Intermediate | 786 | 28.80% | 53.40% | 1.02% | 16.79% | NA |
| Temperate Japonica | 767 | 95.30% | 3.70% | 0.00% | 1.04% | NA |
| Tropical Japonica | 504 | 83.10% | 16.50% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 96.30% | 2.90% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 8.30% | 88.50% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 44.40% | 45.60% | 0.00% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1121160624 | G -> DEL | N | N | silent_mutation | Average:27.828; most accessible tissue: Zhenshan97 young leaf, score: 51.334 | N | N | N | N |
| vg1121160624 | G -> C | LOC_Os11g36005.1 | upstream_gene_variant ; 630.0bp to feature; MODIFIER | silent_mutation | Average:27.828; most accessible tissue: Zhenshan97 young leaf, score: 51.334 | N | N | N | N |
| vg1121160624 | G -> C | LOC_Os11g36010.1 | upstream_gene_variant ; 2330.0bp to feature; MODIFIER | silent_mutation | Average:27.828; most accessible tissue: Zhenshan97 young leaf, score: 51.334 | N | N | N | N |
| vg1121160624 | G -> C | LOC_Os11g36000.1 | downstream_gene_variant ; 1562.0bp to feature; MODIFIER | silent_mutation | Average:27.828; most accessible tissue: Zhenshan97 young leaf, score: 51.334 | N | N | N | N |
| vg1121160624 | G -> C | LOC_Os11g36000-LOC_Os11g36005 | intergenic_region ; MODIFIER | silent_mutation | Average:27.828; most accessible tissue: Zhenshan97 young leaf, score: 51.334 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1121160624 | NA | 6.82E-06 | mr1021 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121160624 | NA | 5.32E-06 | mr1032 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121160624 | NA | 5.91E-06 | mr1165 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121160624 | NA | 1.03E-06 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121160624 | NA | 2.66E-06 | mr1478 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121160624 | NA | 2.15E-06 | mr1971 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |