Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121159482:

Variant ID: vg1121159482 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 21159482
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAAATTATATATCTAACCTTTTCTAGTTAGCACATGGCCCATACTTTTAAGTACCTTTCCGTAGGTATCTTTTATTATAGTTTTTTAAAAAAAAATAAAA[C/T]
ATTTTTATTGAATTTGAATAAATTATAACCAAATTCACAAATATTTGAAAAAAATCCAAAAATTTTGCTCGAAATATTTGCTTGCCAGAGGAGGGGGGTG

Reverse complement sequence

CACCCCCCTCCTCTGGCAAGCAAATATTTCGAGCAAAATTTTTGGATTTTTTTCAAATATTTGTGAATTTGGTTATAATTTATTCAAATTCAATAAAAAT[G/A]
TTTTATTTTTTTTTAAAAAACTATAATAAAAGATACCTACGGAAAGGTACTTAAAAGTATGGGCCATGTGCTAACTAGAAAAGGTTAGATATATAATTTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.80%	9.40%	0.44%	9.39%	NA
All Indica	2759	84.30%	0.70%	0.58%	14.43%	NA
All Japonica	1512	71.50%	27.60%	0.13%	0.79%	NA
Aus	269	91.40%	0.00%	0.00%	8.55%	NA
Indica I	595	96.60%	0.30%	0.00%	3.03%	NA
Indica II	465	78.30%	0.60%	0.65%	20.43%	NA
Indica III	913	81.30%	0.50%	0.33%	17.85%	NA
Indica Intermediate	786	82.20%	1.00%	1.27%	15.52%	NA
Temperate Japonica	767	92.20%	6.80%	0.00%	1.04%	NA
Tropical Japonica	504	39.90%	59.50%	0.20%	0.40%	NA
Japonica Intermediate	241	71.80%	27.00%	0.41%	0.83%	NA
VI/Aromatic	96	93.80%	3.10%	0.00%	3.12%	NA
Intermediate	90	81.10%	6.70%	3.33%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1121159482	C -> T	LOC_Os11g36005.1	upstream_gene_variant ; 1772.0bp to feature; MODIFIER	silent_mutation	Average:42.657; most accessible tissue: Callus, score: 89.071	N	N	N	N
vg1121159482	C -> T	LOC_Os11g36010.1	upstream_gene_variant ; 3472.0bp to feature; MODIFIER	silent_mutation	Average:42.657; most accessible tissue: Callus, score: 89.071	N	N	N	N
vg1121159482	C -> T	LOC_Os11g36000.1	downstream_gene_variant ; 420.0bp to feature; MODIFIER	silent_mutation	Average:42.657; most accessible tissue: Callus, score: 89.071	N	N	N	N
vg1121159482	C -> T	LOC_Os11g36000-LOC_Os11g36005	intergenic_region ; MODIFIER	silent_mutation	Average:42.657; most accessible tissue: Callus, score: 89.071	N	N	N	N
vg1121159482	C -> DEL	N	N	silent_mutation	Average:42.657; most accessible tissue: Callus, score: 89.071	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1121159482	NA	1.24E-06	mr1502	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121159482	NA	9.43E-06	mr1502	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121159482	NA	2.35E-06	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121159482	NA	1.01E-09	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121159482	NA	7.60E-08	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121159482	NA	1.29E-29	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121159482	NA	8.02E-06	mr1742	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121159482	NA	1.12E-14	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121159482	NA	6.38E-19	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121159482	NA	9.66E-13	mr1398_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121159482	NA	1.86E-08	mr1398_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121159482	NA	3.34E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121159482	NA	1.98E-07	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121159482	NA	7.40E-10	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121159482	NA	2.32E-14	mr1742_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121159482	NA	9.33E-13	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251