\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121159482:

Variant ID: vg1121159482 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21159482
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAAATTATATATCTAACCTTTTCTAGTTAGCACATGGCCCATACTTTTAAGTACCTTTCCGTAGGTATCTTTTATTATAGTTTTTTAAAAAAAAATAAAA[C/T]
ATTTTTATTGAATTTGAATAAATTATAACCAAATTCACAAATATTTGAAAAAAATCCAAAAATTTTGCTCGAAATATTTGCTTGCCAGAGGAGGGGGGTG

Reverse complement sequence

CACCCCCCTCCTCTGGCAAGCAAATATTTCGAGCAAAATTTTTGGATTTTTTTCAAATATTTGTGAATTTGGTTATAATTTATTCAAATTCAATAAAAAT[G/A]
TTTTATTTTTTTTTAAAAAACTATAATAAAAGATACCTACGGAAAGGTACTTAAAAGTATGGGCCATGTGCTAACTAGAAAAGGTTAGATATATAATTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.80% 9.40% 0.44% 9.39% NA
All Indica  2759 84.30% 0.70% 0.58% 14.43% NA
All Japonica  1512 71.50% 27.60% 0.13% 0.79% NA
Aus  269 91.40% 0.00% 0.00% 8.55% NA
Indica I  595 96.60% 0.30% 0.00% 3.03% NA
Indica II  465 78.30% 0.60% 0.65% 20.43% NA
Indica III  913 81.30% 0.50% 0.33% 17.85% NA
Indica Intermediate  786 82.20% 1.00% 1.27% 15.52% NA
Temperate Japonica  767 92.20% 6.80% 0.00% 1.04% NA
Tropical Japonica  504 39.90% 59.50% 0.20% 0.40% NA
Japonica Intermediate  241 71.80% 27.00% 0.41% 0.83% NA
VI/Aromatic  96 93.80% 3.10% 0.00% 3.12% NA
Intermediate  90 81.10% 6.70% 3.33% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121159482 C -> T LOC_Os11g36005.1 upstream_gene_variant ; 1772.0bp to feature; MODIFIER silent_mutation Average:42.657; most accessible tissue: Callus, score: 89.071 N N N N
vg1121159482 C -> T LOC_Os11g36010.1 upstream_gene_variant ; 3472.0bp to feature; MODIFIER silent_mutation Average:42.657; most accessible tissue: Callus, score: 89.071 N N N N
vg1121159482 C -> T LOC_Os11g36000.1 downstream_gene_variant ; 420.0bp to feature; MODIFIER silent_mutation Average:42.657; most accessible tissue: Callus, score: 89.071 N N N N
vg1121159482 C -> T LOC_Os11g36000-LOC_Os11g36005 intergenic_region ; MODIFIER silent_mutation Average:42.657; most accessible tissue: Callus, score: 89.071 N N N N
vg1121159482 C -> DEL N N silent_mutation Average:42.657; most accessible tissue: Callus, score: 89.071 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121159482 NA 1.24E-06 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121159482 NA 9.43E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121159482 NA 2.35E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121159482 NA 1.01E-09 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121159482 NA 7.60E-08 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121159482 NA 1.29E-29 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121159482 NA 8.02E-06 mr1742 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121159482 NA 1.12E-14 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121159482 NA 6.38E-19 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121159482 NA 9.66E-13 mr1398_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121159482 NA 1.86E-08 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121159482 NA 3.34E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121159482 NA 1.98E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121159482 NA 7.40E-10 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121159482 NA 2.32E-14 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121159482 NA 9.33E-13 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251