| Variant ID: vg1121116792 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 21116792 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATGATATATTTGCCTACCTATTTATCATATGTCTCTGTTAATATCGTCTTAGCATATCAATTTAGCTCTATCGGCTGCTTCTCGTTTTAGGGATTCTGCC[A/G]
GTATCGGCTAAATCGCGTTGCTAGATTAGATTTGCTTAGACATCTACCACCCTAAAAACTCAGTCAACGGCTTGATTGTCTAGATATTATATTTCTTTTC
GAAAAGAAATATAATATCTAGACAATCAAGCCGTTGACTGAGTTTTTAGGGTGGTAGATGTCTAAGCAAATCTAATCTAGCAACGCGATTTAGCCGATAC[T/C]
GGCAGAATCCCTAAAACGAGAAGCAGCCGATAGAGCTAAATTGATATGCTAAGACGATATTAACAGAGACATATGATAAATAGGTAGGCAAATATATCAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.20% | 15.40% | 0.66% | 11.74% | NA |
| All Indica | 2759 | 76.80% | 4.70% | 1.01% | 17.51% | NA |
| All Japonica | 1512 | 59.50% | 38.20% | 0.20% | 2.12% | NA |
| Aus | 269 | 88.10% | 3.00% | 0.00% | 8.92% | NA |
| Indica I | 595 | 73.40% | 17.80% | 2.02% | 6.72% | NA |
| Indica II | 465 | 72.90% | 0.60% | 1.72% | 24.73% | NA |
| Indica III | 913 | 80.60% | 0.70% | 0.11% | 18.62% | NA |
| Indica Intermediate | 786 | 77.20% | 1.80% | 0.89% | 20.10% | NA |
| Temperate Japonica | 767 | 29.70% | 66.50% | 0.13% | 3.65% | NA |
| Tropical Japonica | 504 | 96.80% | 2.60% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 75.90% | 22.80% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 73.30% | 12.20% | 0.00% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1121116792 | A -> DEL | N | N | silent_mutation | Average:29.211; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 | N | N | N | N |
| vg1121116792 | A -> G | LOC_Os11g35950.1 | upstream_gene_variant ; 1266.0bp to feature; MODIFIER | silent_mutation | Average:29.211; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 | N | N | N | N |
| vg1121116792 | A -> G | LOC_Os11g35940.1 | downstream_gene_variant ; 4554.0bp to feature; MODIFIER | silent_mutation | Average:29.211; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 | N | N | N | N |
| vg1121116792 | A -> G | LOC_Os11g35940-LOC_Os11g35950 | intergenic_region ; MODIFIER | silent_mutation | Average:29.211; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1121116792 | NA | 2.37E-09 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121116792 | NA | 8.52E-08 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121116792 | 1.49E-06 | 1.48E-06 | mr1703 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121116792 | 2.54E-06 | NA | mr1772 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |