Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121038115:

Variant ID: vg1121038115 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 21038115
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTATGTGGAAAGATTGTTTTTCACTTTAGTTATCATTTTTTTAAAAATTCTGCTATAGAATTTTACTATATGTAGAAGAAATCTTACCCCAACATCTTAG[T/A]
TGCGAACACAAAAGCTTTATATGAACACACCATGCACACCAACGAACAAATTTTTACTAAACCTTTAAAAAAAATGTACATGTACTTCAATAGTACTATA

Reverse complement sequence

TATAGTACTATTGAAGTACATGTACATTTTTTTTAAAGGTTTAGTAAAAATTTGTTCGTTGGTGTGCATGGTGTGTTCATATAAAGCTTTTGTGTTCGCA[A/T]
CTAAGATGTTGGGGTAAGATTTCTTCTACATATAGTAAAATTCTATAGCAGAATTTTTAAAAAAATGATAACTAAAGTGAAAAACAATCTTTCCACATAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.70%	8.20%	2.29%	11.79%	NA
All Indica	2759	69.60%	7.90%	3.19%	19.32%	NA
All Japonica	1512	97.60%	0.80%	1.06%	0.53%	NA
Aus	269	41.60%	55.40%	1.49%	1.49%	NA
Indica I	595	89.60%	2.50%	2.18%	5.71%	NA
Indica II	465	69.00%	13.80%	1.72%	15.48%	NA
Indica III	913	59.80%	6.90%	4.38%	28.92%	NA
Indica Intermediate	786	66.30%	9.50%	3.44%	20.74%	NA
Temperate Japonica	767	98.80%	0.40%	0.39%	0.39%	NA
Tropical Japonica	504	95.40%	1.20%	2.38%	0.99%	NA
Japonica Intermediate	241	98.30%	1.20%	0.41%	0.00%	NA
VI/Aromatic	96	96.90%	0.00%	0.00%	3.12%	NA
Intermediate	90	78.90%	11.10%	0.00%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1121038115	T -> A	LOC_Os11g35850.1	upstream_gene_variant ; 2748.0bp to feature; MODIFIER	silent_mutation	Average:50.333; most accessible tissue: Callus, score: 65.749	N	N	N	N
vg1121038115	T -> A	LOC_Os11g35840.1	downstream_gene_variant ; 1361.0bp to feature; MODIFIER	silent_mutation	Average:50.333; most accessible tissue: Callus, score: 65.749	N	N	N	N
vg1121038115	T -> A	LOC_Os11g35840-LOC_Os11g35850	intergenic_region ; MODIFIER	silent_mutation	Average:50.333; most accessible tissue: Callus, score: 65.749	N	N	N	N
vg1121038115	T -> DEL	N	N	silent_mutation	Average:50.333; most accessible tissue: Callus, score: 65.749	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1121038115	NA	7.17E-07	mr1064	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121038115	NA	5.16E-09	mr1280	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121038115	NA	2.38E-07	mr1318	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121038115	NA	4.41E-08	mr1343	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121038115	NA	2.31E-06	mr1534	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121038115	NA	3.76E-06	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121038115	NA	4.86E-06	mr1671	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121038115	NA	5.20E-06	mr1713	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121038115	NA	2.83E-07	mr1729	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121038115	NA	1.40E-08	mr1788	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121038115	NA	7.46E-06	mr1318_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121038115	NA	3.44E-06	mr1671_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121038115	NA	1.90E-06	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121038115	NA	9.24E-09	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251