Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1120996498:

Variant ID: vg1120996498 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 20996498
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

AAGGAGCCGCCATACGATTGCAGTCAAGAGGAGCTTGACGCTTATGTGGCAGGAGAAGTGAAGAGGCAACTCAAGCCTCGGAGTCCTGAAAAGAAGATAC[C/T]
TATTGACCCGAGCATGAAGAAGTTCTTCAAGGGAATGTTCACCACAAACAAGGAGGCCTTAAAGCTATCGGACTATGACCGAACACTTAGGAAAGCCTAT

Reverse complement sequence

ATAGGCTTTCCTAAGTGTTCGGTCATAGTCCGATAGCTTTAAGGCCTCCTTGTTTGTGGTGAACATTCCCTTGAAGAACTTCTTCATGCTCGGGTCAATA[G/A]
GTATCTTCTTTTCAGGACTCCGAGGCTTGAGTTGCCTCTTCACTTCTCCTGCCACATAAGCGTCAAGCTCCTCTTGACTGCAATCGTATGGCGGCTCCTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.60%	6.70%	18.11%	3.66%	NA
All Indica	2759	56.10%	11.10%	28.09%	4.64%	NA
All Japonica	1512	93.70%	0.20%	3.44%	2.65%	NA
Aus	269	97.00%	0.00%	2.23%	0.74%	NA
Indica I	595	63.40%	10.40%	24.20%	2.02%	NA
Indica II	465	40.00%	10.50%	43.66%	5.81%	NA
Indica III	913	62.80%	14.50%	15.99%	6.79%	NA
Indica Intermediate	786	52.50%	8.10%	35.88%	3.44%	NA
Temperate Japonica	767	95.30%	0.30%	3.78%	0.65%	NA
Tropical Japonica	504	89.90%	0.20%	3.77%	6.15%	NA
Japonica Intermediate	241	96.70%	0.00%	1.66%	1.66%	NA
VI/Aromatic	96	93.80%	0.00%	4.17%	2.08%	NA
Intermediate	90	72.20%	5.60%	21.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1120996498	C -> T	LOC_Os11g35762.1	missense_variant ; p.Pro448Leu; MODERATE	nonsynonymous_codon ; P448L	Average:30.155; most accessible tissue: Zhenshan97 flag leaf, score: 51.466	possibly damaging	1.625	DELETERIOUS	0.01
vg1120996498	C -> DEL	LOC_Os11g35762.1	N	frameshift_variant	Average:30.155; most accessible tissue: Zhenshan97 flag leaf, score: 51.466	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1120996498	NA	4.08E-06	mr1014	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120996498	NA	7.15E-06	mr1021	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120996498	NA	7.27E-06	mr1031	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120996498	NA	4.75E-06	mr1324	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120996498	NA	3.50E-06	mr1325	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120996498	NA	2.86E-06	mr1326	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120996498	NA	1.88E-06	mr1363	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120996498	NA	4.90E-06	mr1532	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120996498	NA	2.37E-08	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120996498	3.47E-06	3.47E-06	mr1770	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120996498	NA	4.23E-06	mr1895	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120996498	4.66E-06	2.85E-06	mr1895	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120996498	5.89E-07	5.89E-07	mr1966	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251