\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1120996498:

Variant ID: vg1120996498 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 20996498
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


AAGGAGCCGCCATACGATTGCAGTCAAGAGGAGCTTGACGCTTATGTGGCAGGAGAAGTGAAGAGGCAACTCAAGCCTCGGAGTCCTGAAAAGAAGATAC[C/T]
TATTGACCCGAGCATGAAGAAGTTCTTCAAGGGAATGTTCACCACAAACAAGGAGGCCTTAAAGCTATCGGACTATGACCGAACACTTAGGAAAGCCTAT

Reverse complement sequence

ATAGGCTTTCCTAAGTGTTCGGTCATAGTCCGATAGCTTTAAGGCCTCCTTGTTTGTGGTGAACATTCCCTTGAAGAACTTCTTCATGCTCGGGTCAATA[G/A]
GTATCTTCTTTTCAGGACTCCGAGGCTTGAGTTGCCTCTTCACTTCTCCTGCCACATAAGCGTCAAGCTCCTCTTGACTGCAATCGTATGGCGGCTCCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.60% 6.70% 18.11% 3.66% NA
All Indica  2759 56.10% 11.10% 28.09% 4.64% NA
All Japonica  1512 93.70% 0.20% 3.44% 2.65% NA
Aus  269 97.00% 0.00% 2.23% 0.74% NA
Indica I  595 63.40% 10.40% 24.20% 2.02% NA
Indica II  465 40.00% 10.50% 43.66% 5.81% NA
Indica III  913 62.80% 14.50% 15.99% 6.79% NA
Indica Intermediate  786 52.50% 8.10% 35.88% 3.44% NA
Temperate Japonica  767 95.30% 0.30% 3.78% 0.65% NA
Tropical Japonica  504 89.90% 0.20% 3.77% 6.15% NA
Japonica Intermediate  241 96.70% 0.00% 1.66% 1.66% NA
VI/Aromatic  96 93.80% 0.00% 4.17% 2.08% NA
Intermediate  90 72.20% 5.60% 21.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1120996498 C -> T LOC_Os11g35762.1 missense_variant ; p.Pro448Leu; MODERATE nonsynonymous_codon ; P448L Average:30.155; most accessible tissue: Zhenshan97 flag leaf, score: 51.466 possibly damaging 1.625 DELETERIOUS 0.01
vg1120996498 C -> DEL LOC_Os11g35762.1 N frameshift_variant Average:30.155; most accessible tissue: Zhenshan97 flag leaf, score: 51.466 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1120996498 NA 4.08E-06 mr1014 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120996498 NA 7.15E-06 mr1021 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120996498 NA 7.27E-06 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120996498 NA 4.75E-06 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120996498 NA 3.50E-06 mr1325 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120996498 NA 2.86E-06 mr1326 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120996498 NA 1.88E-06 mr1363 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120996498 NA 4.90E-06 mr1532 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120996498 NA 2.37E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120996498 3.47E-06 3.47E-06 mr1770 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120996498 NA 4.23E-06 mr1895 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120996498 4.66E-06 2.85E-06 mr1895 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120996498 5.89E-07 5.89E-07 mr1966 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251