\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1120940295:

Variant ID: vg1120940295 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 20940295
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTTTGAAACTATTCGAATAGCCGTACTCATGGAGTTGAGTACCAGGACTCATATGGTACCCTGGTTAGAAATCTAAAATCTATATGATTATAAATTCTT[G/A]
CTATAACTCTTCCAGAATATTTATTATTGCTTTTTGCAAAGAACCCTGCTATATGCTAATGCATAACATATTTCCATGATAACTTGCTGAGTATTGTGAA

Reverse complement sequence

TTCACAATACTCAGCAAGTTATCATGGAAATATGTTATGCATTAGCATATAGCAGGGTTCTTTGCAAAAAGCAATAATAAATATTCTGGAAGAGTTATAG[C/T]
AAGAATTTATAATCATATAGATTTTAGATTTCTAACCAGGGTACCATATGAGTCCTGGTACTCAACTCCATGAGTACGGCTATTCGAATAGTTTCAAAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.20% 8.60% 0.36% 0.85% NA
All Indica  2759 87.60% 11.20% 0.40% 0.76% NA
All Japonica  1512 95.20% 3.30% 0.26% 1.19% NA
Aus  269 82.90% 16.70% 0.37% 0.00% NA
Indica I  595 63.50% 36.50% 0.00% 0.00% NA
Indica II  465 95.30% 2.20% 0.22% 2.37% NA
Indica III  913 96.70% 2.40% 0.55% 0.33% NA
Indica Intermediate  786 90.70% 7.80% 0.64% 0.89% NA
Temperate Japonica  767 99.20% 0.70% 0.00% 0.13% NA
Tropical Japonica  504 88.30% 7.50% 0.79% 3.37% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 3.30% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1120940295 G -> A LOC_Os11g35700.1 upstream_gene_variant ; 3220.0bp to feature; MODIFIER silent_mutation Average:35.473; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N
vg1120940295 G -> A LOC_Os11g35710.1 upstream_gene_variant ; 2120.0bp to feature; MODIFIER silent_mutation Average:35.473; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N
vg1120940295 G -> A LOC_Os11g35700-LOC_Os11g35710 intergenic_region ; MODIFIER silent_mutation Average:35.473; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N
vg1120940295 G -> DEL N N silent_mutation Average:35.473; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1120940295 2.56E-06 9.42E-08 mr1298 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120940295 NA 3.72E-07 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251