Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1120940295:

Variant ID: vg1120940295 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 20940295
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTTTGAAACTATTCGAATAGCCGTACTCATGGAGTTGAGTACCAGGACTCATATGGTACCCTGGTTAGAAATCTAAAATCTATATGATTATAAATTCTT[G/A]
CTATAACTCTTCCAGAATATTTATTATTGCTTTTTGCAAAGAACCCTGCTATATGCTAATGCATAACATATTTCCATGATAACTTGCTGAGTATTGTGAA

Reverse complement sequence

TTCACAATACTCAGCAAGTTATCATGGAAATATGTTATGCATTAGCATATAGCAGGGTTCTTTGCAAAAAGCAATAATAAATATTCTGGAAGAGTTATAG[C/T]
AAGAATTTATAATCATATAGATTTTAGATTTCTAACCAGGGTACCATATGAGTCCTGGTACTCAACTCCATGAGTACGGCTATTCGAATAGTTTCAAAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.20%	8.60%	0.36%	0.85%	NA
All Indica	2759	87.60%	11.20%	0.40%	0.76%	NA
All Japonica	1512	95.20%	3.30%	0.26%	1.19%	NA
Aus	269	82.90%	16.70%	0.37%	0.00%	NA
Indica I	595	63.50%	36.50%	0.00%	0.00%	NA
Indica II	465	95.30%	2.20%	0.22%	2.37%	NA
Indica III	913	96.70%	2.40%	0.55%	0.33%	NA
Indica Intermediate	786	90.70%	7.80%	0.64%	0.89%	NA
Temperate Japonica	767	99.20%	0.70%	0.00%	0.13%	NA
Tropical Japonica	504	88.30%	7.50%	0.79%	3.37%	NA
Japonica Intermediate	241	97.10%	2.90%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	3.30%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1120940295	G -> A	LOC_Os11g35700.1	upstream_gene_variant ; 3220.0bp to feature; MODIFIER	silent_mutation	Average:35.473; most accessible tissue: Minghui63 young leaf, score: 47.146	N	N	N	N
vg1120940295	G -> A	LOC_Os11g35710.1	upstream_gene_variant ; 2120.0bp to feature; MODIFIER	silent_mutation	Average:35.473; most accessible tissue: Minghui63 young leaf, score: 47.146	N	N	N	N
vg1120940295	G -> A	LOC_Os11g35700-LOC_Os11g35710	intergenic_region ; MODIFIER	silent_mutation	Average:35.473; most accessible tissue: Minghui63 young leaf, score: 47.146	N	N	N	N
vg1120940295	G -> DEL	N	N	silent_mutation	Average:35.473; most accessible tissue: Minghui63 young leaf, score: 47.146	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1120940295	2.56E-06	9.42E-08	mr1298	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120940295	NA	3.72E-07	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251