Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1120858563:

Variant ID: vg1120858563 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 20858563
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTGCCACAAAGTTGGCAGACCGGACGCGGTCCTTGCTGGCCGCCACCGCGCCCACCGTTTCCACGGCCACAGCCTCCATTGCCGCGACCACGGAAATTG[T/C]
TGTTGTTGTTGCCGCGACCACGGAAAGCAGCATTTGCAGAAGATTGGATCTGCCCTCCGCCTTGAAGATGATCCATGCGGTTGTCGTAGCTAACCATCTA

Reverse complement sequence

TAGATGGTTAGCTACGACAACCGCATGGATCATCTTCAAGGCGGAGGGCAGATCCAATCTTCTGCAAATGCTGCTTTCCGTGGTCGCGGCAACAACAACA[A/G]
CAATTTCCGTGGTCGCGGCAATGGAGGCTGTGGCCGTGGAAACGGTGGGCGCGGTGGCGGCCAGCAAGGACCGCGTCCGGTCTGCCAACTTTGTGGCAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.60% 0.80% 1.12% 0.47% NA
All Indica  2759 99.40% 0.00% 0.40% 0.22% NA
All Japonica  1512 94.10% 2.60% 2.58% 0.66% NA
Aus  269 96.70% 0.00% 1.12% 2.23% NA
Indica I  595 98.30% 0.00% 1.68% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.80% 0.00% 0.00% 0.22% NA
Indica Intermediate  786 99.40% 0.00% 0.13% 0.51% NA
Temperate Japonica  767 90.50% 5.20% 4.30% 0.00% NA
Tropical Japonica  504 97.40% 0.00% 0.79% 1.79% NA
Japonica Intermediate  241 98.80% 0.00% 0.83% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1120858563 T -> DEL LOC_Os11g35570.1 N frameshift_variant Average:62.974; most accessible tissue: Zhenshan97 young leaf, score: 82.077 N N N N
vg1120858563 T -> C LOC_Os11g35570.1 missense_variant ; p.Asn221Ser; MODERATE nonsynonymous_codon Average:62.974; most accessible tissue: Zhenshan97 young leaf, score: 82.077 unknown unknown TOLERATED 0.86

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1120858563 NA 4.04E-07 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120858563 NA 5.47E-07 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120858563 3.31E-07 3.30E-07 mr1456 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120858563 NA 5.52E-06 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120858563 NA 3.14E-09 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120858563 NA 2.05E-08 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120858563 1.83E-06 1.83E-06 mr1587 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120858563 NA 1.64E-06 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120858563 NA 9.13E-06 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120858563 NA 2.29E-08 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251