\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1120838492:

Variant ID: vg1120838492 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 20838492
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGCTATCGCCGGTGTCAATCAAGAGGAGGGCATGGCGGCGGCGTCCTGGTTGTGGACAAGACGAAGGGATGGGGGATAGAAAGGGACAGAGAGAGCGAA[C/A]
AAAAAAAGAGGAAAAAATGCATAAAACTGGGACGGGGTGTGGATCGATCCGTACGCATGGTTGGGACCACATGCGTCGTGTAGCTCTTTTGTATGTGGGC

Reverse complement sequence

GCCCACATACAAAAGAGCTACACGACGCATGTGGTCCCAACCATGCGTACGGATCGATCCACACCCCGTCCCAGTTTTATGCATTTTTTCCTCTTTTTTT[G/T]
TTCGCTCTCTCTGTCCCTTTCTATCCCCCATCCCTTCGTCTTGTCCACAACCAGGACGCCGCCGCCATGCCCTCCTCTTGATTGACACCGGCGATAGCTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.10% 36.70% 0.08% 2.14% NA
All Indica  2759 92.20% 5.50% 0.07% 2.17% NA
All Japonica  1512 7.90% 90.40% 0.00% 1.65% NA
Aus  269 62.80% 31.60% 0.37% 5.20% NA
Indica I  595 82.00% 17.80% 0.17% 0.00% NA
Indica II  465 98.10% 1.30% 0.22% 0.43% NA
Indica III  913 95.00% 1.20% 0.00% 3.83% NA
Indica Intermediate  786 93.30% 3.80% 0.00% 2.93% NA
Temperate Japonica  767 7.20% 92.70% 0.00% 0.13% NA
Tropical Japonica  504 10.90% 84.50% 0.00% 4.56% NA
Japonica Intermediate  241 4.10% 95.40% 0.00% 0.41% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 46.70% 50.00% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1120838492 C -> A LOC_Os11g35540.1 upstream_gene_variant ; 2643.0bp to feature; MODIFIER silent_mutation Average:94.605; most accessible tissue: Zhenshan97 flower, score: 98.24 N N N N
vg1120838492 C -> A LOC_Os11g35550.1 intron_variant ; MODIFIER silent_mutation Average:94.605; most accessible tissue: Zhenshan97 flower, score: 98.24 N N N N
vg1120838492 C -> DEL N N silent_mutation Average:94.605; most accessible tissue: Zhenshan97 flower, score: 98.24 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1120838492 C A 0.01 0.06 0.07 0.02 0.0 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1120838492 NA 3.94E-12 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120838492 NA 6.60E-09 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120838492 NA 4.75E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120838492 NA 1.77E-15 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120838492 NA 8.72E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120838492 NA 1.03E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120838492 NA 1.77E-15 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120838492 NA 1.88E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120838492 NA 3.87E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120838492 NA 2.01E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120838492 NA 1.82E-08 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120838492 3.90E-06 3.41E-11 mr1776 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120838492 NA 2.13E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120838492 NA 4.53E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120838492 NA 4.53E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120838492 NA 8.48E-08 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120838492 NA 8.59E-06 mr1811 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120838492 NA 6.88E-07 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120838492 NA 3.21E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120838492 NA 3.32E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120838492 NA 1.64E-07 mr1758_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251