\
| Variant ID: vg1120836818 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 20836818 |
| Reference Allele: C | Alternative Allele: G,T |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AAGATCTATTTTAAAAATATCATCTACACGTAAACATTCGTAATTAAAATTCAAGCAACATTAAATAATTGCCTGCGCGTATGCGTAGGCTACCTTTCTA[C/G,T]
TTATATAAACGATTAACACAGCAAATCTATCTGAAAAATACATCAGGTCCATCACGACTGACGACGATAGAAATGAGAACAACCCTATTACAATACATCG
CGATGTATTGTAATAGGGTTGTTCTCATTTCTATCGTCGTCAGTCGTGATGGACCTGATGTATTTTTCAGATAGATTTGCTGTGTTAATCGTTTATATAA[G/C,A]
TAGAAAGGTAGCCTACGCATACGCGCAGGCAATTATTTAATGTTGCTTGAATTTTAATTACGAATGTTTACGTGTAGATGATATTTTTAAAATAGATCTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.30% | 8.60% | 0.19% | 1.95% | T: 0.02% |
| All Indica | 2759 | 88.20% | 9.80% | 0.11% | 1.88% | NA |
| All Japonica | 1512 | 97.80% | 0.50% | 0.00% | 1.59% | T: 0.07% |
| Aus | 269 | 50.20% | 43.10% | 1.49% | 5.20% | NA |
| Indica I | 595 | 91.40% | 8.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 86.70% | 13.10% | 0.00% | 0.22% | NA |
| Indica III | 913 | 90.50% | 6.00% | 0.22% | 3.29% | NA |
| Indica Intermediate | 786 | 84.00% | 13.20% | 0.13% | 2.67% | NA |
| Temperate Japonica | 767 | 99.50% | 0.40% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 94.80% | 0.60% | 0.00% | 4.37% | T: 0.20% |
| Japonica Intermediate | 241 | 98.80% | 0.80% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 95.80% | 3.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 8.90% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1120836818 | C -> T | LOC_Os11g35540.1 | upstream_gene_variant ; 969.0bp to feature; MODIFIER | silent_mutation | Average:44.642; most accessible tissue: Callus, score: 76.093 | N | N | N | N |
| vg1120836818 | C -> T | LOC_Os11g35550.1 | downstream_gene_variant ; 331.0bp to feature; MODIFIER | silent_mutation | Average:44.642; most accessible tissue: Callus, score: 76.093 | N | N | N | N |
| vg1120836818 | C -> T | LOC_Os11g35540-LOC_Os11g35550 | intergenic_region ; MODIFIER | silent_mutation | Average:44.642; most accessible tissue: Callus, score: 76.093 | N | N | N | N |
| vg1120836818 | C -> DEL | N | N | silent_mutation | Average:44.642; most accessible tissue: Callus, score: 76.093 | N | N | N | N |
| vg1120836818 | C -> G | LOC_Os11g35540.1 | upstream_gene_variant ; 969.0bp to feature; MODIFIER | silent_mutation | Average:44.642; most accessible tissue: Callus, score: 76.093 | N | N | N | N |
| vg1120836818 | C -> G | LOC_Os11g35550.1 | downstream_gene_variant ; 331.0bp to feature; MODIFIER | silent_mutation | Average:44.642; most accessible tissue: Callus, score: 76.093 | N | N | N | N |
| vg1120836818 | C -> G | LOC_Os11g35540-LOC_Os11g35550 | intergenic_region ; MODIFIER | silent_mutation | Average:44.642; most accessible tissue: Callus, score: 76.093 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1120836818 | 3.72E-06 | 9.69E-07 | mr1604_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120836818 | NA | 5.27E-06 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120836818 | 1.97E-06 | 2.80E-07 | mr1894_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |