\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1120836818:

Variant ID: vg1120836818 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 20836818
Reference Allele: CAlternative Allele: G,T
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGATCTATTTTAAAAATATCATCTACACGTAAACATTCGTAATTAAAATTCAAGCAACATTAAATAATTGCCTGCGCGTATGCGTAGGCTACCTTTCTA[C/G,T]
TTATATAAACGATTAACACAGCAAATCTATCTGAAAAATACATCAGGTCCATCACGACTGACGACGATAGAAATGAGAACAACCCTATTACAATACATCG

Reverse complement sequence

CGATGTATTGTAATAGGGTTGTTCTCATTTCTATCGTCGTCAGTCGTGATGGACCTGATGTATTTTTCAGATAGATTTGCTGTGTTAATCGTTTATATAA[G/C,A]
TAGAAAGGTAGCCTACGCATACGCGCAGGCAATTATTTAATGTTGCTTGAATTTTAATTACGAATGTTTACGTGTAGATGATATTTTTAAAATAGATCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.30% 8.60% 0.19% 1.95% T: 0.02%
All Indica  2759 88.20% 9.80% 0.11% 1.88% NA
All Japonica  1512 97.80% 0.50% 0.00% 1.59% T: 0.07%
Aus  269 50.20% 43.10% 1.49% 5.20% NA
Indica I  595 91.40% 8.60% 0.00% 0.00% NA
Indica II  465 86.70% 13.10% 0.00% 0.22% NA
Indica III  913 90.50% 6.00% 0.22% 3.29% NA
Indica Intermediate  786 84.00% 13.20% 0.13% 2.67% NA
Temperate Japonica  767 99.50% 0.40% 0.00% 0.13% NA
Tropical Japonica  504 94.80% 0.60% 0.00% 4.37% T: 0.20%
Japonica Intermediate  241 98.80% 0.80% 0.00% 0.41% NA
VI/Aromatic  96 95.80% 3.10% 1.04% 0.00% NA
Intermediate  90 87.80% 8.90% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1120836818 C -> T LOC_Os11g35540.1 upstream_gene_variant ; 969.0bp to feature; MODIFIER silent_mutation Average:44.642; most accessible tissue: Callus, score: 76.093 N N N N
vg1120836818 C -> T LOC_Os11g35550.1 downstream_gene_variant ; 331.0bp to feature; MODIFIER silent_mutation Average:44.642; most accessible tissue: Callus, score: 76.093 N N N N
vg1120836818 C -> T LOC_Os11g35540-LOC_Os11g35550 intergenic_region ; MODIFIER silent_mutation Average:44.642; most accessible tissue: Callus, score: 76.093 N N N N
vg1120836818 C -> DEL N N silent_mutation Average:44.642; most accessible tissue: Callus, score: 76.093 N N N N
vg1120836818 C -> G LOC_Os11g35540.1 upstream_gene_variant ; 969.0bp to feature; MODIFIER silent_mutation Average:44.642; most accessible tissue: Callus, score: 76.093 N N N N
vg1120836818 C -> G LOC_Os11g35550.1 downstream_gene_variant ; 331.0bp to feature; MODIFIER silent_mutation Average:44.642; most accessible tissue: Callus, score: 76.093 N N N N
vg1120836818 C -> G LOC_Os11g35540-LOC_Os11g35550 intergenic_region ; MODIFIER silent_mutation Average:44.642; most accessible tissue: Callus, score: 76.093 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1120836818 3.72E-06 9.69E-07 mr1604_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120836818 NA 5.27E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120836818 1.97E-06 2.80E-07 mr1894_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251