\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1120560286:

Variant ID: vg1120560286 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 20560286
Reference Allele: AAlternative Allele: G,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.60, A: 0.40, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


CTATTCCGTGCGTACGTGATCAATCAATAAAAATATAAAATCGTCATAGTGTAAACCAATTCTCTCGGAGATACACTTCGACAGTGCATGTTTCAACCCC[A/G,C]
AAATTCCGTGTTCAATTTCTAATATGCTCATGATTTATTCTTAAAAAAATGTTCAGAGGGGCGTATATCACTTCAAATCTATTTTTTTTAAACCAATTCT

Reverse complement sequence

AGAATTGGTTTAAAAAAAATAGATTTGAAGTGATATACGCCCCTCTGAACATTTTTTTAAGAATAAATCATGAGCATATTAGAAATTGAACACGGAATTT[T/C,G]
GGGGTTGAAACATGCACTGTCGAAGTGTATCTCCGAGAGAATTGGTTTACACTATGACGATTTTATATTTTTATTGATTGATCACGTACGCACGGAATAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.00% 32.50% 0.30% 0.13% C: 0.02%
All Indica  2759 89.10% 10.50% 0.25% 0.11% C: 0.04%
All Japonica  1512 35.60% 64.00% 0.26% 0.13% NA
Aus  269 41.60% 57.60% 0.74% 0.00% NA
Indica I  595 68.70% 30.80% 0.50% 0.00% NA
Indica II  465 96.30% 3.40% 0.00% 0.22% NA
Indica III  913 95.90% 3.80% 0.22% 0.00% NA
Indica Intermediate  786 92.40% 7.00% 0.25% 0.25% C: 0.13%
Temperate Japonica  767 18.50% 81.50% 0.00% 0.00% NA
Tropical Japonica  504 49.40% 49.80% 0.60% 0.20% NA
Japonica Intermediate  241 61.00% 38.20% 0.41% 0.41% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 56.70% 41.10% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1120560286 A -> DEL N N silent_mutation Average:51.881; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1120560286 A -> G LOC_Os11g35070.1 downstream_gene_variant ; 872.0bp to feature; MODIFIER silent_mutation Average:51.881; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1120560286 A -> G LOC_Os11g35070-LOC_Os11g35080 intergenic_region ; MODIFIER silent_mutation Average:51.881; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1120560286 A -> C LOC_Os11g35070.1 downstream_gene_variant ; 872.0bp to feature; MODIFIER silent_mutation Average:51.881; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1120560286 A -> C LOC_Os11g35070-LOC_Os11g35080 intergenic_region ; MODIFIER silent_mutation Average:51.881; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1120560286 NA 2.43E-07 mr1298 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120560286 NA 2.92E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251