\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1120481051:

Variant ID: vg1120481051 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 20481051
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCATATAAATGTTAATGAATCTAAACACATATATTGTCTAGTTTCATAAAATATATATGAATGTGGGTAATACTAGAAAGTTTTATATTATGAAACGGAT[G/A]
AAGTATCTTTAAAAAAATTAGTGTAAAATTTAGATGTCTCGAGGTACTTTTCGAAGAATGGTAAAATTTCTGAAGGAGGAAATATCCCAATGCAGTCTTG

Reverse complement sequence

CAAGACTGCATTGGGATATTTCCTCCTTCAGAAATTTTACCATTCTTCGAAAAGTACCTCGAGACATCTAAATTTTACACTAATTTTTTTAAAGATACTT[C/T]
ATCCGTTTCATAATATAAAACTTTCTAGTATTACCCACATTCATATATATTTTATGAAACTAGACAATATATGTGTTTAGATTCATTAACATTTATATGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.30% 4.60% 0.59% 22.53% NA
All Indica  2759 69.00% 0.20% 0.72% 30.08% NA
All Japonica  1512 81.90% 12.50% 0.07% 5.56% NA
Aus  269 45.00% 5.20% 1.86% 47.96% NA
Indica I  595 52.40% 0.30% 0.67% 46.55% NA
Indica II  465 78.70% 0.00% 0.86% 20.43% NA
Indica III  913 67.60% 0.30% 0.88% 31.22% NA
Indica Intermediate  786 77.40% 0.10% 0.51% 22.01% NA
Temperate Japonica  767 73.00% 22.90% 0.00% 4.04% NA
Tropical Japonica  504 89.10% 1.00% 0.00% 9.92% NA
Japonica Intermediate  241 95.00% 3.30% 0.41% 1.24% NA
VI/Aromatic  96 83.30% 0.00% 2.08% 14.58% NA
Intermediate  90 82.20% 8.90% 0.00% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1120481051 G -> A LOC_Os11g34940.1 upstream_gene_variant ; 2181.0bp to feature; MODIFIER silent_mutation Average:77.804; most accessible tissue: Minghui63 young leaf, score: 95.862 N N N N
vg1120481051 G -> A LOC_Os11g34950.2 downstream_gene_variant ; 1570.0bp to feature; MODIFIER silent_mutation Average:77.804; most accessible tissue: Minghui63 young leaf, score: 95.862 N N N N
vg1120481051 G -> A LOC_Os11g34950.1 downstream_gene_variant ; 1570.0bp to feature; MODIFIER silent_mutation Average:77.804; most accessible tissue: Minghui63 young leaf, score: 95.862 N N N N
vg1120481051 G -> A LOC_Os11g34940-LOC_Os11g34950 intergenic_region ; MODIFIER silent_mutation Average:77.804; most accessible tissue: Minghui63 young leaf, score: 95.862 N N N N
vg1120481051 G -> DEL N N silent_mutation Average:77.804; most accessible tissue: Minghui63 young leaf, score: 95.862 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1120481051 G A 0.02 0.03 0.04 0.01 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1120481051 NA 5.28E-06 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120481051 NA 5.38E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120481051 NA 8.77E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120481051 NA 5.38E-06 mr1321_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120481051 NA 4.14E-07 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120481051 NA 7.03E-06 mr1428_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120481051 2.47E-07 NA mr1517_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120481051 NA 9.29E-07 mr1517_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120481051 8.76E-06 NA mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120481051 5.36E-06 NA mr1539_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120481051 6.01E-06 NA mr1539_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120481051 NA 4.52E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120481051 2.13E-06 2.75E-07 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120481051 7.46E-06 1.12E-06 mr1577_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120481051 7.43E-06 NA mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120481051 NA 4.63E-07 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120481051 7.73E-06 NA mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120481051 4.91E-10 NA mr1768_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120481051 NA 3.20E-08 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120481051 NA 9.46E-07 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120481051 NA 2.23E-07 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251