\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1120477715:

Variant ID: vg1120477715 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 20477715
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGAATATCCGAAACTTTATCCACTCCTTGCATTAGAAACGAACAGGACCTATGTATGCATCCTACTTCCTCTTCCAAATTATAAGATCTATATTTTTTTT[A/G]
CACGGTCTTCAATGAGATACTTTGACTAGTATTTTATTTCATGTTATGTTTCCAACAAATATGAAATTAGCATTACAAGAAAGTATTTCAAAATATGAAT

Reverse complement sequence

ATTCATATTTTGAAATACTTTCTTGTAATGCTAATTTCATATTTGTTGGAAACATAACATGAAATAAAATACTAGTCAAAGTATCTCATTGAAGACCGTG[T/C]
AAAAAAAATATAGATCTTATAATTTGGAAGAGGAAGTAGGATGCATACATAGGTCCTGTTCGTTTCTAATGCAAGGAGTGGATAAAGTTTCGGATATTCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.90% 4.30% 0.72% 22.13% NA
All Indica  2759 69.40% 0.20% 1.01% 29.36% NA
All Japonica  1512 82.00% 12.50% 0.07% 5.42% NA
Aus  269 51.30% 0.00% 1.86% 46.84% NA
Indica I  595 54.30% 0.30% 2.18% 43.19% NA
Indica II  465 79.60% 0.00% 0.22% 20.22% NA
Indica III  913 66.80% 0.30% 0.88% 31.98% NA
Indica Intermediate  786 77.90% 0.10% 0.76% 21.25% NA
Temperate Japonica  767 73.10% 22.90% 0.00% 3.91% NA
Tropical Japonica  504 89.30% 1.00% 0.00% 9.72% NA
Japonica Intermediate  241 95.00% 3.30% 0.41% 1.24% NA
VI/Aromatic  96 79.20% 0.00% 0.00% 20.83% NA
Intermediate  90 83.30% 7.80% 0.00% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1120477715 A -> DEL N N silent_mutation Average:32.499; most accessible tissue: Callus, score: 76.5 N N N N
vg1120477715 A -> G LOC_Os11g34940.1 downstream_gene_variant ; 461.0bp to feature; MODIFIER silent_mutation Average:32.499; most accessible tissue: Callus, score: 76.5 N N N N
vg1120477715 A -> G LOC_Os11g34950.2 downstream_gene_variant ; 4906.0bp to feature; MODIFIER silent_mutation Average:32.499; most accessible tissue: Callus, score: 76.5 N N N N
vg1120477715 A -> G LOC_Os11g34950.1 downstream_gene_variant ; 4906.0bp to feature; MODIFIER silent_mutation Average:32.499; most accessible tissue: Callus, score: 76.5 N N N N
vg1120477715 A -> G LOC_Os11g34930-LOC_Os11g34940 intergenic_region ; MODIFIER silent_mutation Average:32.499; most accessible tissue: Callus, score: 76.5 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1120477715 NA 1.76E-06 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120477715 NA 2.63E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120477715 2.19E-06 2.19E-06 mr1193_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120477715 2.39E-06 3.14E-08 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120477715 NA 4.06E-06 mr1321_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120477715 NA 5.00E-07 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120477715 NA 1.87E-06 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120477715 5.06E-08 NA mr1517_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120477715 NA 1.64E-07 mr1517_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120477715 7.49E-06 NA mr1537_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120477715 2.42E-06 NA mr1539_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120477715 8.88E-06 NA mr1539_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120477715 NA 4.26E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120477715 1.73E-06 3.88E-08 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120477715 NA 7.67E-07 mr1577_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120477715 3.75E-06 NA mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120477715 NA 2.75E-07 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120477715 NA 5.78E-06 mr1738_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120477715 2.63E-06 NA mr1740_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120477715 3.06E-09 NA mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120477715 NA 7.02E-08 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120477715 NA 4.17E-06 mr1792_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120477715 NA 2.72E-06 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120477715 NA 9.69E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120477715 3.99E-06 NA mr1890_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120477715 4.18E-06 NA mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120477715 NA 3.25E-07 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120477715 NA 3.19E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251