\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1120455169:

Variant ID: vg1120455169 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 20455169
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTTTAGCGGAAATAAAAGTTACCCTCGAAATTGATGGATCGCGGTCTGACCGAAGTAGTTGCGCCGGTCTGACCGCCTGATGAACGTCGGTCTGACCGA[T/C]
GTAGATTGATCGGTCGAACTGCTGAAAACGCCTGTCGCCGACTCCTGTAGCTGCCGGTCTGACCGTCGTGTGCCCGCCGGTCGGACCGCCGAGATGCCGC

Reverse complement sequence

GCGGCATCTCGGCGGTCCGACCGGCGGGCACACGACGGTCAGACCGGCAGCTACAGGAGTCGGCGACAGGCGTTTTCAGCAGTTCGACCGATCAATCTAC[A/G]
TCGGTCAGACCGACGTTCATCAGGCGGTCAGACCGGCGCAACTACTTCGGTCAGACCGCGATCCATCAATTTCGAGGGTAACTTTTATTTCCGCTAAAAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.50% 4.30% 9.65% 12.55% NA
All Indica  2759 71.20% 0.20% 11.89% 16.71% NA
All Japonica  1512 79.80% 12.90% 3.77% 3.51% NA
Aus  269 53.50% 0.00% 23.79% 22.68% NA
Indica I  595 50.80% 0.30% 14.12% 34.79% NA
Indica II  465 78.10% 0.20% 4.95% 16.77% NA
Indica III  913 75.00% 0.00% 17.52% 7.45% NA
Indica Intermediate  786 78.20% 0.30% 7.76% 13.74% NA
Temperate Japonica  767 88.30% 5.60% 5.35% 0.78% NA
Tropical Japonica  504 60.30% 28.80% 2.18% 8.73% NA
Japonica Intermediate  241 93.80% 2.90% 2.07% 1.24% NA
VI/Aromatic  96 82.30% 1.00% 5.21% 11.46% NA
Intermediate  90 87.80% 2.20% 2.22% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1120455169 T -> DEL N N silent_mutation Average:35.435; most accessible tissue: Minghui63 root, score: 69.344 N N N N
vg1120455169 T -> C LOC_Os11g34880.1 upstream_gene_variant ; 4885.0bp to feature; MODIFIER silent_mutation Average:35.435; most accessible tissue: Minghui63 root, score: 69.344 N N N N
vg1120455169 T -> C LOC_Os11g34900.1 upstream_gene_variant ; 401.0bp to feature; MODIFIER silent_mutation Average:35.435; most accessible tissue: Minghui63 root, score: 69.344 N N N N
vg1120455169 T -> C LOC_Os11g34890.1 downstream_gene_variant ; 1597.0bp to feature; MODIFIER silent_mutation Average:35.435; most accessible tissue: Minghui63 root, score: 69.344 N N N N
vg1120455169 T -> C LOC_Os11g34910.1 downstream_gene_variant ; 162.0bp to feature; MODIFIER silent_mutation Average:35.435; most accessible tissue: Minghui63 root, score: 69.344 N N N N
vg1120455169 T -> C LOC_Os11g34900-LOC_Os11g34910 intergenic_region ; MODIFIER silent_mutation Average:35.435; most accessible tissue: Minghui63 root, score: 69.344 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1120455169 7.98E-07 NA mr1103 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120455169 3.08E-06 NA mr1241 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120455169 2.11E-08 NA mr1560 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120455169 NA 3.88E-06 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120455169 NA 5.28E-06 mr1174_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120455169 NA 3.71E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120455169 NA 3.98E-06 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120455169 7.60E-06 NA mr1758_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120455169 NA 1.26E-06 mr1758_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120455169 NA 3.22E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120455169 NA 1.31E-08 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251