\
| Variant ID: vg1120455169 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 20455169 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CTTTTAGCGGAAATAAAAGTTACCCTCGAAATTGATGGATCGCGGTCTGACCGAAGTAGTTGCGCCGGTCTGACCGCCTGATGAACGTCGGTCTGACCGA[T/C]
GTAGATTGATCGGTCGAACTGCTGAAAACGCCTGTCGCCGACTCCTGTAGCTGCCGGTCTGACCGTCGTGTGCCCGCCGGTCGGACCGCCGAGATGCCGC
GCGGCATCTCGGCGGTCCGACCGGCGGGCACACGACGGTCAGACCGGCAGCTACAGGAGTCGGCGACAGGCGTTTTCAGCAGTTCGACCGATCAATCTAC[A/G]
TCGGTCAGACCGACGTTCATCAGGCGGTCAGACCGGCGCAACTACTTCGGTCAGACCGCGATCCATCAATTTCGAGGGTAACTTTTATTTCCGCTAAAAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.50% | 4.30% | 9.65% | 12.55% | NA |
| All Indica | 2759 | 71.20% | 0.20% | 11.89% | 16.71% | NA |
| All Japonica | 1512 | 79.80% | 12.90% | 3.77% | 3.51% | NA |
| Aus | 269 | 53.50% | 0.00% | 23.79% | 22.68% | NA |
| Indica I | 595 | 50.80% | 0.30% | 14.12% | 34.79% | NA |
| Indica II | 465 | 78.10% | 0.20% | 4.95% | 16.77% | NA |
| Indica III | 913 | 75.00% | 0.00% | 17.52% | 7.45% | NA |
| Indica Intermediate | 786 | 78.20% | 0.30% | 7.76% | 13.74% | NA |
| Temperate Japonica | 767 | 88.30% | 5.60% | 5.35% | 0.78% | NA |
| Tropical Japonica | 504 | 60.30% | 28.80% | 2.18% | 8.73% | NA |
| Japonica Intermediate | 241 | 93.80% | 2.90% | 2.07% | 1.24% | NA |
| VI/Aromatic | 96 | 82.30% | 1.00% | 5.21% | 11.46% | NA |
| Intermediate | 90 | 87.80% | 2.20% | 2.22% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1120455169 | T -> DEL | N | N | silent_mutation | Average:35.435; most accessible tissue: Minghui63 root, score: 69.344 | N | N | N | N |
| vg1120455169 | T -> C | LOC_Os11g34880.1 | upstream_gene_variant ; 4885.0bp to feature; MODIFIER | silent_mutation | Average:35.435; most accessible tissue: Minghui63 root, score: 69.344 | N | N | N | N |
| vg1120455169 | T -> C | LOC_Os11g34900.1 | upstream_gene_variant ; 401.0bp to feature; MODIFIER | silent_mutation | Average:35.435; most accessible tissue: Minghui63 root, score: 69.344 | N | N | N | N |
| vg1120455169 | T -> C | LOC_Os11g34890.1 | downstream_gene_variant ; 1597.0bp to feature; MODIFIER | silent_mutation | Average:35.435; most accessible tissue: Minghui63 root, score: 69.344 | N | N | N | N |
| vg1120455169 | T -> C | LOC_Os11g34910.1 | downstream_gene_variant ; 162.0bp to feature; MODIFIER | silent_mutation | Average:35.435; most accessible tissue: Minghui63 root, score: 69.344 | N | N | N | N |
| vg1120455169 | T -> C | LOC_Os11g34900-LOC_Os11g34910 | intergenic_region ; MODIFIER | silent_mutation | Average:35.435; most accessible tissue: Minghui63 root, score: 69.344 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1120455169 | 7.98E-07 | NA | mr1103 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120455169 | 3.08E-06 | NA | mr1241 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120455169 | 2.11E-08 | NA | mr1560 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120455169 | NA | 3.88E-06 | mr1620 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120455169 | NA | 5.28E-06 | mr1174_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120455169 | NA | 3.71E-06 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120455169 | NA | 3.98E-06 | mr1743_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120455169 | 7.60E-06 | NA | mr1758_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120455169 | NA | 1.26E-06 | mr1758_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120455169 | NA | 3.22E-06 | mr1866_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120455169 | NA | 1.31E-08 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |