Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1120403301:

Variant ID: vg1120403301 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 20403301
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCTTAGTTTTCCTATGTGCAATTGTGATCTGTTCATAGACATGATTCCCTATCTATTTTTTAGTTTTCTGGTCTCCAATTTGTTAATCTTCTATTCTTA[G/A]
TTTTCTGATATGCAATTTGTTAGTATGCCATGATCCCCCTTGATCTCCTCTCCTCATTTATTCATATGCAACGTGTTCATATTCCTGTCGTATATCTGCT

Reverse complement sequence

AGCAGATATACGACAGGAATATGAACACGTTGCATATGAATAAATGAGGAGAGGAGATCAAGGGGGATCATGGCATACTAACAAATTGCATATCAGAAAA[C/T]
TAAGAATAGAAGATTAACAAATTGGAGACCAGAAAACTAAAAAATAGATAGGGAATCATGTCTATGAACAGATCACAATTGCACATAGGAAAACTAAGAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	29.30%	2.70%	0.51%	67.48%	NA
All Indica	2759	11.20%	0.00%	0.54%	88.22%	NA
All Japonica	1512	54.60%	8.30%	0.46%	36.64%	NA
Aus	269	49.40%	0.00%	0.37%	50.19%	NA
Indica I	595	4.70%	0.00%	0.17%	95.13%	NA
Indica II	465	5.40%	0.00%	0.43%	94.19%	NA
Indica III	913	17.70%	0.00%	1.10%	81.16%	NA
Indica Intermediate	786	12.00%	0.10%	0.25%	87.66%	NA
Temperate Japonica	767	66.50%	15.90%	0.52%	17.08%	NA
Tropical Japonica	504	46.20%	0.00%	0.40%	53.37%	NA
Japonica Intermediate	241	34.40%	1.20%	0.41%	63.90%	NA
VI/Aromatic	96	83.30%	0.00%	0.00%	16.67%	NA
Intermediate	90	43.30%	0.00%	1.11%	55.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1120403301	G -> A	LOC_Os11g34830.1	upstream_gene_variant ; 4507.0bp to feature; MODIFIER	silent_mutation	Average:11.439; most accessible tissue: Callus, score: 75.317	N	N	N	N
vg1120403301	G -> A	LOC_Os11g34820.1	downstream_gene_variant ; 1479.0bp to feature; MODIFIER	silent_mutation	Average:11.439; most accessible tissue: Callus, score: 75.317	N	N	N	N
vg1120403301	G -> A	LOC_Os11g34824.1	intron_variant ; MODIFIER	silent_mutation	Average:11.439; most accessible tissue: Callus, score: 75.317	N	N	N	N
vg1120403301	G -> DEL	N	N	silent_mutation	Average:11.439; most accessible tissue: Callus, score: 75.317	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1120403301	NA	4.17E-06	mr1126	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120403301	NA	1.06E-06	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120403301	NA	6.92E-06	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120403301	NA	8.62E-06	mr1379	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120403301	7.94E-07	7.94E-07	mr1456	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120403301	NA	8.17E-09	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120403301	NA	2.90E-06	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120403301	2.35E-06	2.35E-06	mr1687	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120403301	NA	2.55E-06	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251