\
| Variant ID: vg1120315862 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 20315862 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CAGCAAAAATTTTGAAAAATACTATCGCGGAGATACATGAGTTGCAAAATACCGTCTCTGAGAATGGCATGTGGGACTTGGACCCACGTGTTAATGACAT[G/A]
TACGACGGTATTTTCCATCTCCGTGATTTTTACGATGGTACCAAGCAAACTCTGATTTTTGACAAACTCCGTGTTCTTTTTATAATGGTAATAGGCAAAT
ATTTGCCTATTACCATTATAAAAAGAACACGGAGTTTGTCAAAAATCAGAGTTTGCTTGGTACCATCGTAAAAATCACGGAGATGGAAAATACCGTCGTA[C/T]
ATGTCATTAACACGTGGGTCCAAGTCCCACATGCCATTCTCAGAGACGGTATTTTGCAACTCATGTATCTCCGCGATAGTATTTTTCAAAATTTTTGCTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.10% | 16.70% | 1.42% | 1.78% | NA |
| All Indica | 2759 | 77.70% | 18.00% | 1.88% | 2.43% | NA |
| All Japonica | 1512 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 7.80% | 81.00% | 4.83% | 6.32% | NA |
| Indica I | 595 | 75.30% | 14.30% | 3.53% | 6.89% | NA |
| Indica II | 465 | 78.30% | 20.40% | 1.08% | 0.22% | NA |
| Indica III | 913 | 77.00% | 20.60% | 1.31% | 1.10% | NA |
| Indica Intermediate | 786 | 80.00% | 16.30% | 1.78% | 1.91% | NA |
| Temperate Japonica | 767 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 90.50% | 9.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 10.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1120315862 | G -> A | LOC_Os11g34660.1 | downstream_gene_variant ; 1904.0bp to feature; MODIFIER | silent_mutation | Average:52.202; most accessible tissue: Minghui63 flower, score: 73.172 | N | N | N | N |
| vg1120315862 | G -> A | LOC_Os11g34680.1 | intron_variant ; MODIFIER | silent_mutation | Average:52.202; most accessible tissue: Minghui63 flower, score: 73.172 | N | N | N | N |
| vg1120315862 | G -> DEL | N | N | silent_mutation | Average:52.202; most accessible tissue: Minghui63 flower, score: 73.172 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1120315862 | NA | 5.41E-08 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120315862 | NA | 2.81E-06 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120315862 | NA | 1.16E-07 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120315862 | NA | 3.91E-10 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120315862 | NA | 8.00E-10 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120315862 | 5.42E-07 | 2.47E-06 | mr1050_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120315862 | NA | 5.82E-06 | mr1092_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120315862 | NA | 4.11E-06 | mr1152_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120315862 | NA | 1.52E-09 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120315862 | NA | 1.67E-08 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |