\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1120315862:

Variant ID: vg1120315862 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 20315862
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGCAAAAATTTTGAAAAATACTATCGCGGAGATACATGAGTTGCAAAATACCGTCTCTGAGAATGGCATGTGGGACTTGGACCCACGTGTTAATGACAT[G/A]
TACGACGGTATTTTCCATCTCCGTGATTTTTACGATGGTACCAAGCAAACTCTGATTTTTGACAAACTCCGTGTTCTTTTTATAATGGTAATAGGCAAAT

Reverse complement sequence

ATTTGCCTATTACCATTATAAAAAGAACACGGAGTTTGTCAAAAATCAGAGTTTGCTTGGTACCATCGTAAAAATCACGGAGATGGAAAATACCGTCGTA[C/T]
ATGTCATTAACACGTGGGTCCAAGTCCCACATGCCATTCTCAGAGACGGTATTTTGCAACTCATGTATCTCCGCGATAGTATTTTTCAAAATTTTTGCTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.10% 16.70% 1.42% 1.78% NA
All Indica  2759 77.70% 18.00% 1.88% 2.43% NA
All Japonica  1512 95.60% 4.40% 0.00% 0.00% NA
Aus  269 7.80% 81.00% 4.83% 6.32% NA
Indica I  595 75.30% 14.30% 3.53% 6.89% NA
Indica II  465 78.30% 20.40% 1.08% 0.22% NA
Indica III  913 77.00% 20.60% 1.31% 1.10% NA
Indica Intermediate  786 80.00% 16.30% 1.78% 1.91% NA
Temperate Japonica  767 97.80% 2.20% 0.00% 0.00% NA
Tropical Japonica  504 90.50% 9.50% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 10.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1120315862 G -> A LOC_Os11g34660.1 downstream_gene_variant ; 1904.0bp to feature; MODIFIER silent_mutation Average:52.202; most accessible tissue: Minghui63 flower, score: 73.172 N N N N
vg1120315862 G -> A LOC_Os11g34680.1 intron_variant ; MODIFIER silent_mutation Average:52.202; most accessible tissue: Minghui63 flower, score: 73.172 N N N N
vg1120315862 G -> DEL N N silent_mutation Average:52.202; most accessible tissue: Minghui63 flower, score: 73.172 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1120315862 NA 5.41E-08 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120315862 NA 2.81E-06 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120315862 NA 1.16E-07 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120315862 NA 3.91E-10 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120315862 NA 8.00E-10 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120315862 5.42E-07 2.47E-06 mr1050_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120315862 NA 5.82E-06 mr1092_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120315862 NA 4.11E-06 mr1152_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120315862 NA 1.52E-09 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120315862 NA 1.67E-08 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251