Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1120254935:

Variant ID: vg1120254935 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 20254935
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCCCCGACTTCAACTCAAATGAATCCACGTTTTATCCGTTAGCGTTGTCATGCTCACTTGGTCGTTCTTGACAACAATTGAGAAGACGTGTAGTACTCAA[T/C]
ATCATTGAAAAAAATTAACGGTCCACAAGTGAATTTGAATTGAAGTCTACACAACTACCATAAACGGGCCTGAAATCAACGCAAATGAACGAGTTGATGT

Reverse complement sequence

ACATCAACTCGTTCATTTGCGTTGATTTCAGGCCCGTTTATGGTAGTTGTGTAGACTTCAATTCAAATTCACTTGTGGACCGTTAATTTTTTTCAATGAT[A/G]
TTGAGTACTACACGTCTTCTCAATTGTTGTCAAGAACGACCAAGTGAGCATGACAACGCTAACGGATAAAACGTGGATTCATTTGAGTTGAAGTCGGGGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.20%	31.30%	0.34%	35.19%	NA
All Indica	2759	14.70%	41.00%	0.25%	44.04%	NA
All Japonica	1512	69.30%	3.00%	0.46%	27.18%	NA
Aus	269	2.60%	94.40%	0.00%	2.97%	NA
Indica I	595	35.80%	27.10%	0.17%	36.97%	NA
Indica II	465	7.70%	57.40%	0.22%	34.62%	NA
Indica III	913	1.80%	44.20%	0.22%	53.78%	NA
Indica Intermediate	786	17.80%	38.20%	0.38%	43.64%	NA
Temperate Japonica	767	85.70%	4.60%	0.00%	9.78%	NA
Tropical Japonica	504	53.80%	1.00%	0.99%	44.25%	NA
Japonica Intermediate	241	49.80%	2.50%	0.83%	46.89%	NA
VI/Aromatic	96	71.90%	18.80%	0.00%	9.38%	NA
Intermediate	90	42.20%	33.30%	2.22%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1120254935	T -> DEL	N	N	silent_mutation	Average:25.53; most accessible tissue: Callus, score: 51.501	N	N	N	N
vg1120254935	T -> C	LOC_Os11g34600.1	upstream_gene_variant ; 1438.0bp to feature; MODIFIER	silent_mutation	Average:25.53; most accessible tissue: Callus, score: 51.501	N	N	N	N
vg1120254935	T -> C	LOC_Os11g34610.1	upstream_gene_variant ; 1931.0bp to feature; MODIFIER	silent_mutation	Average:25.53; most accessible tissue: Callus, score: 51.501	N	N	N	N
vg1120254935	T -> C	LOC_Os11g34600-LOC_Os11g34610	intergenic_region ; MODIFIER	silent_mutation	Average:25.53; most accessible tissue: Callus, score: 51.501	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1120254935	1.74E-07	NA	mr1219	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251