\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1120196683:

Variant ID: vg1120196683 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 20196683
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAAGTGCTAGCTCACCTCTGCACACGTTCGTACGTACGCTAGCTCCGGCCATCTCAAACACTTCTGCTGTGTTCTTTTTTCAGCGTGTTCTCGAAACAC[C/A]
TCTCGTTTTTCACGTGCACGCTTTTAAACTGATAAACGATACCTTTTTTTTTGCAAAAATATAAAAGTTACTTTAAAAAATCATATTAATCTATTTTTTT

Reverse complement sequence

AAAAAAATAGATTAATATGATTTTTTAAAGTAACTTTTATATTTTTGCAAAAAAAAAGGTATCGTTTATCAGTTTAAAAGCGTGCACGTGAAAAACGAGA[G/T]
GTGTTTCGAGAACACGCTGAAAAAAGAACACAGCAGAAGTGTTTGAGATGGCCGGAGCTAGCGTACGTACGAACGTGTGCAGAGGTGAGCTAGCACTTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.20% 8.40% 0.32% 45.15% NA
All Indica  2759 31.90% 11.30% 0.43% 56.40% NA
All Japonica  1512 64.60% 0.00% 0.20% 35.25% NA
Aus  269 65.40% 30.10% 0.00% 4.46% NA
Indica I  595 4.90% 24.50% 0.17% 70.42% NA
Indica II  465 56.30% 1.50% 0.86% 41.29% NA
Indica III  913 37.00% 8.70% 0.22% 54.11% NA
Indica Intermediate  786 31.90% 10.10% 0.64% 57.38% NA
Temperate Japonica  767 85.00% 0.00% 0.00% 14.99% NA
Tropical Japonica  504 47.00% 0.00% 0.60% 52.38% NA
Japonica Intermediate  241 36.10% 0.00% 0.00% 63.90% NA
VI/Aromatic  96 94.80% 0.00% 0.00% 5.21% NA
Intermediate  90 65.60% 3.30% 0.00% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1120196683 C -> A LOC_Os11g34470.1 upstream_gene_variant ; 1886.0bp to feature; MODIFIER silent_mutation Average:53.332; most accessible tissue: Callus, score: 97.39 N N N N
vg1120196683 C -> A LOC_Os11g34470-LOC_Os11g34480 intergenic_region ; MODIFIER silent_mutation Average:53.332; most accessible tissue: Callus, score: 97.39 N N N N
vg1120196683 C -> DEL N N silent_mutation Average:53.332; most accessible tissue: Callus, score: 97.39 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1120196683 C A -0.03 0.0 -0.02 -0.03 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1120196683 NA 2.43E-06 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120196683 NA 7.09E-07 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120196683 NA 1.11E-08 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120196683 NA 1.13E-08 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120196683 3.20E-06 3.03E-08 mr1170_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120196683 NA 8.97E-08 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120196683 NA 4.61E-08 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251