\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1120079549:

Variant ID: vg1120079549 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 20079549
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


TTTAGTTGGATAATTACGACCAATGAAACATGGCCGGATGTCTCGAGCATGCAGCTCGTCTAGATACTAAGAGGTCTAATAATGTAATTAACACATCAAC[C/T]
GAGCTAGTGGTAATTAAGCATGGCTAAGCACATAGTTCTAGCTAGGTTACATAAGTAACACGAGCTAGTCGAATTATCACCCAAGTTTAATAAAGGACGG

Reverse complement sequence

CCGTCCTTTATTAAACTTGGGTGATAATTCGACTAGCTCGTGTTACTTATGTAACCTAGCTAGAACTATGTGCTTAGCCATGCTTAATTACCACTAGCTC[G/A]
GTTGATGTGTTAATTACATTATTAGACCTCTTAGTATCTAGACGAGCTGCATGCTCGAGACATCCGGCCATGTTTCATTGGTCGTAATTATCCAACTAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.10% 15.70% 0.00% 6.24% NA
All Indica  2759 98.90% 1.00% 0.00% 0.14% NA
All Japonica  1512 39.90% 41.00% 0.00% 19.05% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 99.10% 0.60% 0.00% 0.22% NA
Indica III  913 99.80% 0.10% 0.00% 0.11% NA
Indica Intermediate  786 97.30% 2.40% 0.00% 0.25% NA
Temperate Japonica  767 20.60% 62.50% 0.00% 16.95% NA
Tropical Japonica  504 55.80% 14.70% 0.00% 29.56% NA
Japonica Intermediate  241 68.50% 27.80% 0.00% 3.73% NA
VI/Aromatic  96 31.20% 67.70% 0.00% 1.04% NA
Intermediate  90 67.80% 30.00% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1120079549 C -> T LOC_Os11g34290.1 upstream_gene_variant ; 4848.0bp to feature; MODIFIER silent_mutation Average:57.699; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 N N N N
vg1120079549 C -> T LOC_Os11g34270.1 downstream_gene_variant ; 4818.0bp to feature; MODIFIER silent_mutation Average:57.699; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 N N N N
vg1120079549 C -> T LOC_Os11g34280.1 downstream_gene_variant ; 1988.0bp to feature; MODIFIER silent_mutation Average:57.699; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 N N N N
vg1120079549 C -> T LOC_Os11g34280-LOC_Os11g34290 intergenic_region ; MODIFIER silent_mutation Average:57.699; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 N N N N
vg1120079549 C -> DEL N N silent_mutation Average:57.699; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1120079549 NA 1.83E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120079549 NA 1.11E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120079549 NA 3.34E-07 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120079549 NA 3.74E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120079549 NA 1.75E-07 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120079549 NA 1.68E-06 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120079549 1.22E-06 NA mr1807_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120079549 8.25E-06 NA mr1807_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120079549 NA 1.73E-10 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120079549 NA 3.86E-16 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120079549 NA 3.60E-17 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251