\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119999188:

Variant ID: vg1119999188 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 19999188
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTAATGTACAATTATTGCTAGAGCTACCTATTCTAAACAGATGCAAAATAATTTCATATAACCTCTCGCCCACCCACCGGCGATCACTTTCCCCAAAT[C/T]
ATGGGTTCTTCGTCCCTACTCTCCATGTTGTCGATGGAATTGTCGCTATGGATCCAAGCCTCCTCCTCTCCCTCCCCCTTACCATGGTGACACCATTGCC

Reverse complement sequence

GGCAATGGTGTCACCATGGTAAGGGGGAGGGAGAGGAGGAGGCTTGGATCCATAGCGACAATTCCATCGACAACATGGAGAGTAGGGACGAAGAACCCAT[G/A]
ATTTGGGGAAAGTGATCGCCGGTGGGTGGGCGAGAGGTTATATGAAATTATTTTGCATCTGTTTAGAATAGGTAGCTCTAGCAATAATTGTACATTAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.60% 2.10% 0.32% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 92.60% 6.40% 0.99% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 86.40% 11.90% 1.69% 0.00% NA
Tropical Japonica  504 99.20% 0.40% 0.40% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1119999188 C -> T LOC_Os11g34150.1 upstream_gene_variant ; 2215.0bp to feature; MODIFIER silent_mutation Average:73.727; most accessible tissue: Callus, score: 83.698 N N N N
vg1119999188 C -> T LOC_Os11g34150.2 upstream_gene_variant ; 2215.0bp to feature; MODIFIER silent_mutation Average:73.727; most accessible tissue: Callus, score: 83.698 N N N N
vg1119999188 C -> T LOC_Os11g34150.3 upstream_gene_variant ; 2215.0bp to feature; MODIFIER silent_mutation Average:73.727; most accessible tissue: Callus, score: 83.698 N N N N
vg1119999188 C -> T LOC_Os11g34160.1 downstream_gene_variant ; 2818.0bp to feature; MODIFIER silent_mutation Average:73.727; most accessible tissue: Callus, score: 83.698 N N N N
vg1119999188 C -> T LOC_Os11g34150-LOC_Os11g34160 intergenic_region ; MODIFIER silent_mutation Average:73.727; most accessible tissue: Callus, score: 83.698 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1119999188 9.30E-06 5.96E-08 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119999188 1.13E-06 5.07E-09 mr1310 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119999188 1.42E-06 1.42E-06 mr1409 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119999188 NA 9.99E-06 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119999188 5.10E-07 2.94E-09 mr1926 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119999188 2.51E-06 3.38E-07 mr1959 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251