\
| Variant ID: vg1119999188 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 19999188 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 304. )
TTTTAATGTACAATTATTGCTAGAGCTACCTATTCTAAACAGATGCAAAATAATTTCATATAACCTCTCGCCCACCCACCGGCGATCACTTTCCCCAAAT[C/T]
ATGGGTTCTTCGTCCCTACTCTCCATGTTGTCGATGGAATTGTCGCTATGGATCCAAGCCTCCTCCTCTCCCTCCCCCTTACCATGGTGACACCATTGCC
GGCAATGGTGTCACCATGGTAAGGGGGAGGGAGAGGAGGAGGCTTGGATCCATAGCGACAATTCCATCGACAACATGGAGAGTAGGGACGAAGAACCCAT[G/A]
ATTTGGGGAAAGTGATCGCCGGTGGGTGGGCGAGAGGTTATATGAAATTATTTTGCATCTGTTTAGAATAGGTAGCTCTAGCAATAATTGTACATTAAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.60% | 2.10% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 92.60% | 6.40% | 0.99% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 86.40% | 11.90% | 1.69% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.40% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1119999188 | C -> T | LOC_Os11g34150.1 | upstream_gene_variant ; 2215.0bp to feature; MODIFIER | silent_mutation | Average:73.727; most accessible tissue: Callus, score: 83.698 | N | N | N | N |
| vg1119999188 | C -> T | LOC_Os11g34150.2 | upstream_gene_variant ; 2215.0bp to feature; MODIFIER | silent_mutation | Average:73.727; most accessible tissue: Callus, score: 83.698 | N | N | N | N |
| vg1119999188 | C -> T | LOC_Os11g34150.3 | upstream_gene_variant ; 2215.0bp to feature; MODIFIER | silent_mutation | Average:73.727; most accessible tissue: Callus, score: 83.698 | N | N | N | N |
| vg1119999188 | C -> T | LOC_Os11g34160.1 | downstream_gene_variant ; 2818.0bp to feature; MODIFIER | silent_mutation | Average:73.727; most accessible tissue: Callus, score: 83.698 | N | N | N | N |
| vg1119999188 | C -> T | LOC_Os11g34150-LOC_Os11g34160 | intergenic_region ; MODIFIER | silent_mutation | Average:73.727; most accessible tissue: Callus, score: 83.698 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1119999188 | 9.30E-06 | 5.96E-08 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119999188 | 1.13E-06 | 5.07E-09 | mr1310 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119999188 | 1.42E-06 | 1.42E-06 | mr1409 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119999188 | NA | 9.99E-06 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119999188 | 5.10E-07 | 2.94E-09 | mr1926 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119999188 | 2.51E-06 | 3.38E-07 | mr1959 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |