\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119967965:

Variant ID: vg1119967965 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 19967965
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


ATTAATCATATTTTATCATCTAACAACAATGAAAATACAAATTATAAAAAAATTTCATATAAGACGGACAGTTAAAGTTGGACATGAAAACCTATAGTTT[G/A]
TCTTTTTTTGGATGGAGGGAGTAATCCTCTATTAGTTTCTCATCAATACTAGTAGTACGTACTACCGCTAGTCCGCTACTAGCTAACCGTGCCTCTGGCC

Reverse complement sequence

GGCCAGAGGCACGGTTAGCTAGTAGCGGACTAGCGGTAGTACGTACTACTAGTATTGATGAGAAACTAATAGAGGATTACTCCCTCCATCCAAAAAAAGA[C/T]
AAACTATAGGTTTTCATGTCCAACTTTAACTGTCCGTCTTATATGAAATTTTTTTATAATTTGTATTTTCATTGTTGTTAGATGATAAAATATGATTAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.30% 47.10% 0.55% 0.00% NA
All Indica  2759 43.50% 56.10% 0.40% 0.00% NA
All Japonica  1512 62.90% 36.90% 0.20% 0.00% NA
Aus  269 63.20% 33.80% 2.97% 0.00% NA
Indica I  595 35.80% 64.20% 0.00% 0.00% NA
Indica II  465 44.50% 55.10% 0.43% 0.00% NA
Indica III  913 43.50% 56.20% 0.33% 0.00% NA
Indica Intermediate  786 48.90% 50.40% 0.76% 0.00% NA
Temperate Japonica  767 81.00% 18.90% 0.13% 0.00% NA
Tropical Japonica  504 48.60% 51.20% 0.20% 0.00% NA
Japonica Intermediate  241 35.30% 64.30% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 0.00% 3.12% 0.00% NA
Intermediate  90 64.40% 34.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1119967965 G -> A LOC_Os11g34110.1 upstream_gene_variant ; 4666.0bp to feature; MODIFIER silent_mutation Average:45.135; most accessible tissue: Callus, score: 84.404 N N N N
vg1119967965 G -> A LOC_Os11g34120.1 downstream_gene_variant ; 3815.0bp to feature; MODIFIER silent_mutation Average:45.135; most accessible tissue: Callus, score: 84.404 N N N N
vg1119967965 G -> A LOC_Os11g34110-LOC_Os11g34120 intergenic_region ; MODIFIER silent_mutation Average:45.135; most accessible tissue: Callus, score: 84.404 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1119967965 3.24E-06 NA mr1632_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119967965 NA 9.42E-06 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119967965 NA 6.50E-06 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251