\
| Variant ID: vg1119967965 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 19967965 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 89. )
ATTAATCATATTTTATCATCTAACAACAATGAAAATACAAATTATAAAAAAATTTCATATAAGACGGACAGTTAAAGTTGGACATGAAAACCTATAGTTT[G/A]
TCTTTTTTTGGATGGAGGGAGTAATCCTCTATTAGTTTCTCATCAATACTAGTAGTACGTACTACCGCTAGTCCGCTACTAGCTAACCGTGCCTCTGGCC
GGCCAGAGGCACGGTTAGCTAGTAGCGGACTAGCGGTAGTACGTACTACTAGTATTGATGAGAAACTAATAGAGGATTACTCCCTCCATCCAAAAAAAGA[C/T]
AAACTATAGGTTTTCATGTCCAACTTTAACTGTCCGTCTTATATGAAATTTTTTTATAATTTGTATTTTCATTGTTGTTAGATGATAAAATATGATTAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.30% | 47.10% | 0.55% | 0.00% | NA |
| All Indica | 2759 | 43.50% | 56.10% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 62.90% | 36.90% | 0.20% | 0.00% | NA |
| Aus | 269 | 63.20% | 33.80% | 2.97% | 0.00% | NA |
| Indica I | 595 | 35.80% | 64.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 44.50% | 55.10% | 0.43% | 0.00% | NA |
| Indica III | 913 | 43.50% | 56.20% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 48.90% | 50.40% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 81.00% | 18.90% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 48.60% | 51.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 35.30% | 64.30% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 34.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1119967965 | G -> A | LOC_Os11g34110.1 | upstream_gene_variant ; 4666.0bp to feature; MODIFIER | silent_mutation | Average:45.135; most accessible tissue: Callus, score: 84.404 | N | N | N | N |
| vg1119967965 | G -> A | LOC_Os11g34120.1 | downstream_gene_variant ; 3815.0bp to feature; MODIFIER | silent_mutation | Average:45.135; most accessible tissue: Callus, score: 84.404 | N | N | N | N |
| vg1119967965 | G -> A | LOC_Os11g34110-LOC_Os11g34120 | intergenic_region ; MODIFIER | silent_mutation | Average:45.135; most accessible tissue: Callus, score: 84.404 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1119967965 | 3.24E-06 | NA | mr1632_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119967965 | NA | 9.42E-06 | mr1693_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119967965 | NA | 6.50E-06 | mr1788_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |