\
| Variant ID: vg1119960918 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 19960918 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AATGTTGAGAGCATATATATATTTAGAGGTACCTGTCTATCTTTAGTTAAAATAACGTAAGATATCATAATAAAGGTTTGACAAACTTCACCAAGTTGGG[A/C]
AAGTTCAGCTTTATGGCTTACATATACTTGGTTCTTTAACCCAAGAGAAATCAATAGAATATATACACATGTACATATGCATGTTAATCTATTAGGTGTA
TACACCTAATAGATTAACATGCATATGTACATGTGTATATATTCTATTGATTTCTCTTGGGTTAAAGAACCAAGTATATGTAAGCCATAAAGCTGAACTT[T/G]
CCCAACTTGGTGAAGTTTGTCAAACCTTTATTATGATATCTTACGTTATTTTAACTAAAGATAGACAGGTACCTCTAAATATATATATGCTCTCAACATT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.90% | 5.10% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 37.20% | 62.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 72.90% | 26.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1119960918 | A -> C | LOC_Os11g34110.1 | intron_variant ; MODIFIER | silent_mutation | Average:40.633; most accessible tissue: Minghui63 root, score: 68.826 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1119960918 | NA | 5.06E-06 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119960918 | 6.96E-11 | 1.26E-46 | mr1549 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119960918 | 8.89E-12 | 3.17E-54 | mr1550 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119960918 | 3.13E-10 | 2.71E-49 | mr1757 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119960918 | NA | 1.72E-06 | mr1762 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119960918 | NA | 1.79E-34 | mr1549_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119960918 | 1.71E-06 | 1.53E-50 | mr1550_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119960918 | NA | 8.65E-34 | mr1757_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |