\
| Variant ID: vg1119958954 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 19958954 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 80. )
CTTAGTTTCCTCCATGAAAAATATTGTTAAACAATTAATATATCTAAAGAAAATAAACAAATCGTGGAATGGGGAACATATTGCGGTGTTCAAACATTAT[A/T]
TGCATTCACATCCCAAAATGCATGATCATTATTGTTTAGGTTAATTTGTTGTTGAACTTTTTAGTATTTAAGTACACCCTCCGTGCAAAAAGAATCAACT
AGTTGATTCTTTTTGCACGGAGGGTGTACTTAAATACTAAAAAGTTCAACAACAAATTAACCTAAACAATAATGATCATGCATTTTGGGATGTGAATGCA[T/A]
ATAATGTTTGAACACCGCAATATGTTCCCCATTCCACGATTTGTTTATTTTCTTTAGATATATTAATTGTTTAACAATATTTTTCATGGAGGAAACTAAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.50% | 0.60% | 3.89% | 55.10% | NA |
| All Indica | 2759 | 14.90% | 0.80% | 5.58% | 78.72% | NA |
| All Japonica | 1512 | 92.10% | 0.10% | 0.79% | 6.94% | NA |
| Aus | 269 | 0.40% | 0.00% | 1.86% | 97.77% | NA |
| Indica I | 595 | 10.10% | 0.80% | 2.35% | 86.72% | NA |
| Indica II | 465 | 3.20% | 0.40% | 2.80% | 93.55% | NA |
| Indica III | 913 | 22.80% | 1.10% | 10.51% | 65.61% | NA |
| Indica Intermediate | 786 | 16.30% | 0.60% | 3.94% | 79.13% | NA |
| Temperate Japonica | 767 | 94.00% | 0.00% | 0.13% | 5.87% | NA |
| Tropical Japonica | 504 | 89.50% | 0.40% | 1.39% | 8.73% | NA |
| Japonica Intermediate | 241 | 91.70% | 0.00% | 1.66% | 6.64% | NA |
| VI/Aromatic | 96 | 69.80% | 1.00% | 10.42% | 18.75% | NA |
| Intermediate | 90 | 44.40% | 1.10% | 3.33% | 51.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1119958954 | A -> T | LOC_Os11g34100.1 | downstream_gene_variant ; 3109.0bp to feature; MODIFIER | silent_mutation | Average:22.012; most accessible tissue: Callus, score: 49.81 | N | N | N | N |
| vg1119958954 | A -> T | LOC_Os11g34110.1 | intron_variant ; MODIFIER | silent_mutation | Average:22.012; most accessible tissue: Callus, score: 49.81 | N | N | N | N |
| vg1119958954 | A -> DEL | N | N | silent_mutation | Average:22.012; most accessible tissue: Callus, score: 49.81 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1119958954 | NA | 1.48E-34 | mr1670 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119958954 | 1.88E-06 | 1.88E-06 | mr1710 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119958954 | NA | 4.03E-18 | mr1767 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119958954 | NA | 2.03E-07 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119958954 | NA | 2.40E-08 | mr1921_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |