Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119957243:

Variant ID: vg1119957243 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 19957243
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTTCCAGTAGAATCCCTGAACCAGTACTGGGATAACGTTGCATGCTACGAGAACAAAGATCATCAGAGCATGCTTGCCCATCCACTCCATGGGAAGAAC[T/C]
GGCCTCTTGTACCCTTTCACATCCACCTAACAAAACGATTTCATGTTAATTATTAATCGTCAAAACAGCTGTCATGCTTAATTACCAAAGGGCACAATAA

Reverse complement sequence

TTATTGTGCCCTTTGGTAATTAAGCATGACAGCTGTTTTGACGATTAATAATTAACATGAAATCGTTTTGTTAGGTGGATGTGAAAGGGTACAAGAGGCC[A/G]
GTTCTTCCCATGGAGTGGATGGGCAAGCATGCTCTGATGATCTTTGTTCTCGTAGCATGCAACGTTATCCCAGTACTGGTTCAGGGATTCTACTGGAAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.60% 40.30% 0.02% 0.00% NA
All Indica  2759 85.30% 14.70% 0.00% 0.00% NA
All Japonica  1512 7.90% 92.10% 0.00% 0.00% NA
Aus  269 98.90% 0.70% 0.37% 0.00% NA
Indica I  595 89.60% 10.40% 0.00% 0.00% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 77.70% 22.30% 0.00% 0.00% NA
Indica Intermediate  786 84.00% 16.00% 0.00% 0.00% NA
Temperate Japonica  767 6.00% 94.00% 0.00% 0.00% NA
Tropical Japonica  504 10.50% 89.50% 0.00% 0.00% NA
Japonica Intermediate  241 8.70% 91.30% 0.00% 0.00% NA
VI/Aromatic  96 30.20% 69.80% 0.00% 0.00% NA
Intermediate  90 55.60% 44.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1119957243 T -> C LOC_Os11g34110.1 synonymous_variant ; p.Pro401Pro; LOW synonymous_codon Average:52.33; most accessible tissue: Zhenshan97 root, score: 88.158 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1119957243 T C 0.01 -0.01 -0.01 -0.03 -0.04 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1119957243 NA 7.61E-09 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119957243 NA 3.71E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119957243 NA 1.25E-11 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119957243 NA 1.05E-35 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119957243 NA 3.73E-19 mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119957243 2.31E-06 8.72E-07 mr1988 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119957243 NA 5.07E-13 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119957243 NA 6.09E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119957243 8.02E-07 NA mr1504_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119957243 NA 3.89E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119957243 NA 1.74E-07 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119957243 NA 2.34E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251