\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119948255:

Variant ID: vg1119948255 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 19948255
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.59, A: 0.41, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TAAGCTAGGTTAATAGTCAAACATATATAAATAAAAACAATAACGTCTTACATCAAAATTCAGAGGAAGTACTACACACATATCAATACTACTTCTCTTG[T/A]
GGAAATGCCATTGCCGTAGACAATGAATCACGTGATCCACGTGCCTGCAGGACGATGTTCCTTCCTTTGGGCACAAACCTAGCAATTTTTTTTTGTTACA

Reverse complement sequence

TGTAACAAAAAAAAATTGCTAGGTTTGTGCCCAAAGGAAGGAACATCGTCCTGCAGGCACGTGGATCACGTGATTCATTGTCTACGGCAATGGCATTTCC[A/T]
CAAGAGAAGTAGTATTGATATGTGTGTAGTACTTCCTCTGAATTTTGATGTAAGACGTTATTGTTTTTATTTATATATGTTTGACTATTAACCTAGCTTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.60% 40.20% 0.19% 0.02% NA
All Indica  2759 85.20% 14.50% 0.29% 0.04% NA
All Japonica  1512 7.90% 92.10% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 89.40% 10.10% 0.50% 0.00% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 77.30% 22.20% 0.44% 0.00% NA
Indica Intermediate  786 84.00% 15.80% 0.13% 0.13% NA
Temperate Japonica  767 5.90% 94.00% 0.13% 0.00% NA
Tropical Japonica  504 10.50% 89.50% 0.00% 0.00% NA
Japonica Intermediate  241 8.70% 91.30% 0.00% 0.00% NA
VI/Aromatic  96 30.20% 69.80% 0.00% 0.00% NA
Intermediate  90 55.60% 44.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1119948255 T -> A LOC_Os11g34090.1 upstream_gene_variant ; 1378.0bp to feature; MODIFIER silent_mutation Average:53.119; most accessible tissue: Callus, score: 91.414 N N N N
vg1119948255 T -> A LOC_Os11g34080-LOC_Os11g34090 intergenic_region ; MODIFIER silent_mutation Average:53.119; most accessible tissue: Callus, score: 91.414 N N N N
vg1119948255 T -> DEL N N silent_mutation Average:53.119; most accessible tissue: Callus, score: 91.414 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1119948255 5.52E-06 5.52E-06 mr1417 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119948255 4.49E-06 4.49E-06 mr1497 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119948255 NA 1.28E-08 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119948255 8.84E-07 3.02E-07 mr1988 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251