Variant ID: vg1119948255 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 19948255 |
Reference Allele: T | Alternative Allele: A |
Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.59, A: 0.41, others allele: 0.00, population size: 103. )
TAAGCTAGGTTAATAGTCAAACATATATAAATAAAAACAATAACGTCTTACATCAAAATTCAGAGGAAGTACTACACACATATCAATACTACTTCTCTTG[T/A]
GGAAATGCCATTGCCGTAGACAATGAATCACGTGATCCACGTGCCTGCAGGACGATGTTCCTTCCTTTGGGCACAAACCTAGCAATTTTTTTTTGTTACA
TGTAACAAAAAAAAATTGCTAGGTTTGTGCCCAAAGGAAGGAACATCGTCCTGCAGGCACGTGGATCACGTGATTCATTGTCTACGGCAATGGCATTTCC[A/T]
CAAGAGAAGTAGTATTGATATGTGTGTAGTACTTCCTCTGAATTTTGATGTAAGACGTTATTGTTTTTATTTATATATGTTTGACTATTAACCTAGCTTA
Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 59.60% | 40.20% | 0.19% | 0.02% | NA |
All Indica | 2759 | 85.20% | 14.50% | 0.29% | 0.04% | NA |
All Japonica | 1512 | 7.90% | 92.10% | 0.07% | 0.00% | NA |
Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica I | 595 | 89.40% | 10.10% | 0.50% | 0.00% | NA |
Indica II | 465 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
Indica III | 913 | 77.30% | 22.20% | 0.44% | 0.00% | NA |
Indica Intermediate | 786 | 84.00% | 15.80% | 0.13% | 0.13% | NA |
Temperate Japonica | 767 | 5.90% | 94.00% | 0.13% | 0.00% | NA |
Tropical Japonica | 504 | 10.50% | 89.50% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 8.70% | 91.30% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 30.20% | 69.80% | 0.00% | 0.00% | NA |
Intermediate | 90 | 55.60% | 44.40% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1119948255 | T -> A | LOC_Os11g34090.1 | upstream_gene_variant ; 1378.0bp to feature; MODIFIER | silent_mutation | Average:53.119; most accessible tissue: Callus, score: 91.414 | N | N | N | N |
vg1119948255 | T -> A | LOC_Os11g34080-LOC_Os11g34090 | intergenic_region ; MODIFIER | silent_mutation | Average:53.119; most accessible tissue: Callus, score: 91.414 | N | N | N | N |
vg1119948255 | T -> DEL | N | N | silent_mutation | Average:53.119; most accessible tissue: Callus, score: 91.414 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1119948255 | 5.52E-06 | 5.52E-06 | mr1417 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1119948255 | 4.49E-06 | 4.49E-06 | mr1497 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1119948255 | NA | 1.28E-08 | mr1595 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1119948255 | 8.84E-07 | 3.02E-07 | mr1988 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |