Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119923282:

Variant ID: vg1119923282 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 19923282
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.73, A: 0.28, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


TTTATGATTCATTTGCCTACCCTTTACGTTGTGCGTCTACAAACGTCACTCACTTAACGCGTAATTGAGATCGTGGACGAAAAGATTTAGCGTGTAGTAG[A/C]
TTTTCTTTTGGAGCGAAGGGCACGAGATGTGTGTGATGCTGTCTGATGGATCCGTTTAGTTTGTGAGGTCAACAGTGGAGGACATACAGTGCGCATTTTG

Reverse complement sequence

CAAAATGCGCACTGTATGTCCTCCACTGTTGACCTCACAAACTAAACGGATCCATCAGACAGCATCACACACATCTCGTGCCCTTCGCTCCAAAAGAAAA[T/G]
CTACTACACGCTAAATCTTTTCGTCCACGATCTCAATTACGCGTTAAGTGAGTGACGTTTGTAGACGCACAACGTAAAGGGTAGGCAAATGAATCATAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.10% 36.50% 0.34% 0.00% NA
All Indica  2759 69.30% 30.30% 0.36% 0.00% NA
All Japonica  1512 59.10% 40.70% 0.26% 0.00% NA
Aus  269 18.60% 81.40% 0.00% 0.00% NA
Indica I  595 58.50% 41.30% 0.17% 0.00% NA
Indica II  465 67.50% 32.30% 0.22% 0.00% NA
Indica III  913 79.10% 20.60% 0.33% 0.00% NA
Indica Intermediate  786 67.30% 32.10% 0.64% 0.00% NA
Temperate Japonica  767 86.00% 13.70% 0.26% 0.00% NA
Tropical Japonica  504 30.20% 69.40% 0.40% 0.00% NA
Japonica Intermediate  241 33.60% 66.40% 0.00% 0.00% NA
VI/Aromatic  96 66.70% 33.30% 0.00% 0.00% NA
Intermediate  90 70.00% 27.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1119923282 A -> C LOC_Os11g34070.1 upstream_gene_variant ; 1939.0bp to feature; MODIFIER silent_mutation Average:71.587; most accessible tissue: Zhenshan97 flower, score: 94.016 N N N N
vg1119923282 A -> C LOC_Os11g34060-LOC_Os11g34070 intergenic_region ; MODIFIER silent_mutation Average:71.587; most accessible tissue: Zhenshan97 flower, score: 94.016 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1119923282 A C 0.06 -0.04 -0.1 0.15 0.22 0.29

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1119923282 NA 2.41E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119923282 NA 2.62E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119923282 NA 3.59E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119923282 2.01E-06 3.27E-07 mr1527 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119923282 NA 2.41E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119923282 NA 1.96E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119923282 NA 1.94E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119923282 NA 5.66E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119923282 NA 7.84E-08 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119923282 NA 1.39E-08 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119923282 NA 9.36E-09 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251