\
| Variant ID: vg1119904700 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 19904700 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 80. )
AGGTTATTTCCTGGGCAGCGTGCTGTAAAGACGGGGTTATTATGGGCCTTAGCCAAGAAGTCATCCAAGCCTTTAGTGATTGAAGATGTTCCTGTAGTGC[G/A]
AGATTATCCTGATGTTTTTCCCGCAGAATTGCCAGGGATGCCACCTGAGCGTGATGTAGAGTTCCGTATTGATCTTGTTCCTAGTACACAACCTATCTCC
GGAGATAGGTTGTGTACTAGGAACAAGATCAATACGGAACTCTACATCACGCTCAGGTGGCATCCCTGGCAATTCTGCGGGAAAAACATCAGGATAATCT[C/T]
GCACTACAGGAACATCTTCAATCACTAAAGGCTTGGATGACTTCTTGGCTAAGGCCCATAATAACCCCGTCTTTACAGCACGCTGCCCAGGAAATAACCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 21.60% | 8.80% | 35.46% | 34.15% | NA |
| All Indica | 2759 | 4.30% | 13.60% | 50.42% | 31.61% | NA |
| All Japonica | 1512 | 53.20% | 0.30% | 6.81% | 39.68% | NA |
| Aus | 269 | 0.40% | 11.90% | 45.35% | 42.38% | NA |
| Indica I | 595 | 1.30% | 41.70% | 34.62% | 22.35% | NA |
| Indica II | 465 | 4.10% | 2.80% | 63.01% | 30.11% | NA |
| Indica III | 913 | 5.10% | 1.50% | 57.83% | 35.49% | NA |
| Indica Intermediate | 786 | 5.90% | 12.80% | 46.31% | 34.99% | NA |
| Temperate Japonica | 767 | 80.60% | 0.70% | 5.35% | 13.43% | NA |
| Tropical Japonica | 504 | 21.80% | 0.00% | 10.12% | 68.06% | NA |
| Japonica Intermediate | 241 | 31.50% | 0.00% | 4.56% | 63.90% | NA |
| VI/Aromatic | 96 | 66.70% | 0.00% | 31.25% | 2.08% | NA |
| Intermediate | 90 | 33.30% | 4.40% | 33.33% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1119904700 | G -> A | LOC_Os11g34050.1 | missense_variant ; p.Arg179Gln; MODERATE | nonsynonymous_codon ; R179Q | Average:15.264; most accessible tissue: Zhenshan97 root, score: 25.639 | benign |
0.749 |
TOLERATED | 0.42 |
| vg1119904700 | G -> DEL | LOC_Os11g34050.1 | N | frameshift_variant | Average:15.264; most accessible tissue: Zhenshan97 root, score: 25.639 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1119904700 | NA | 4.56E-06 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119904700 | NA | 2.43E-09 | mr1047 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119904700 | 7.14E-06 | 7.28E-07 | mr1179 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119904700 | NA | 2.05E-06 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119904700 | NA | 6.59E-06 | mr1231 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119904700 | NA | 6.73E-06 | mr1625 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119904700 | NA | 9.31E-07 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119904700 | NA | 4.89E-06 | mr1510_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119904700 | NA | 1.65E-06 | mr1624_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119904700 | NA | 2.41E-06 | mr1834_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |