\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119904700:

Variant ID: vg1119904700 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 19904700
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


AGGTTATTTCCTGGGCAGCGTGCTGTAAAGACGGGGTTATTATGGGCCTTAGCCAAGAAGTCATCCAAGCCTTTAGTGATTGAAGATGTTCCTGTAGTGC[G/A]
AGATTATCCTGATGTTTTTCCCGCAGAATTGCCAGGGATGCCACCTGAGCGTGATGTAGAGTTCCGTATTGATCTTGTTCCTAGTACACAACCTATCTCC

Reverse complement sequence

GGAGATAGGTTGTGTACTAGGAACAAGATCAATACGGAACTCTACATCACGCTCAGGTGGCATCCCTGGCAATTCTGCGGGAAAAACATCAGGATAATCT[C/T]
GCACTACAGGAACATCTTCAATCACTAAAGGCTTGGATGACTTCTTGGCTAAGGCCCATAATAACCCCGTCTTTACAGCACGCTGCCCAGGAAATAACCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 21.60% 8.80% 35.46% 34.15% NA
All Indica  2759 4.30% 13.60% 50.42% 31.61% NA
All Japonica  1512 53.20% 0.30% 6.81% 39.68% NA
Aus  269 0.40% 11.90% 45.35% 42.38% NA
Indica I  595 1.30% 41.70% 34.62% 22.35% NA
Indica II  465 4.10% 2.80% 63.01% 30.11% NA
Indica III  913 5.10% 1.50% 57.83% 35.49% NA
Indica Intermediate  786 5.90% 12.80% 46.31% 34.99% NA
Temperate Japonica  767 80.60% 0.70% 5.35% 13.43% NA
Tropical Japonica  504 21.80% 0.00% 10.12% 68.06% NA
Japonica Intermediate  241 31.50% 0.00% 4.56% 63.90% NA
VI/Aromatic  96 66.70% 0.00% 31.25% 2.08% NA
Intermediate  90 33.30% 4.40% 33.33% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1119904700 G -> A LOC_Os11g34050.1 missense_variant ; p.Arg179Gln; MODERATE nonsynonymous_codon ; R179Q Average:15.264; most accessible tissue: Zhenshan97 root, score: 25.639 benign 0.749 TOLERATED 0.42
vg1119904700 G -> DEL LOC_Os11g34050.1 N frameshift_variant Average:15.264; most accessible tissue: Zhenshan97 root, score: 25.639 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1119904700 NA 4.56E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119904700 NA 2.43E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119904700 7.14E-06 7.28E-07 mr1179 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119904700 NA 2.05E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119904700 NA 6.59E-06 mr1231 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119904700 NA 6.73E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119904700 NA 9.31E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119904700 NA 4.89E-06 mr1510_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119904700 NA 1.65E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119904700 NA 2.41E-06 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251