Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1119903744:

Variant ID: vg1119903744 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 19903744
Reference Allele: G	Alternative Allele: T,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:

ACGTCCGGACGGTCAGATATCATGCGGGATACTTAGTCAAGAGTTCAATGCACGTGGTTGGTGACGATTCCATATGGCATACGATGGAGATATTGTGTGC[G/T,A]
TATGGGATGCAGAGTCGAATTTGGAAGGAGTCCAAATTTGGTATGATTGGAGTTTGTAAAGTTTGTTTCTTGTACGGGAAGGTTTCCTAGATGGATTAGG

Reverse complement sequence

CCTAATCCATCTAGGAAACCTTCCCGTACAAGAAACAAACTTTACAAACTCCAATCATACCAAATTTGGACTCCTTCCAAATTCGACTCTGCATCCCATA[C/A,T]
GCACACAATATCTCCATCGTATGCCATATGGAATCGTCACCAACCACGTGCATTGAACTCTTGACTAAGTATCCCGCATGATATCTGACCGTCCGGACGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.60%	16.30%	0.08%	0.02%	A: 0.04%
All Indica	2759	93.70%	6.10%	0.11%	0.04%	NA
All Japonica	1512	60.50%	39.40%	0.00%	0.00%	A: 0.13%
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	86.40%	13.40%	0.22%	0.00%	NA
Indica Intermediate	786	94.10%	5.60%	0.13%	0.13%	NA
Temperate Japonica	767	87.20%	12.80%	0.00%	0.00%	NA
Tropical Japonica	504	31.50%	68.50%	0.00%	0.00%	NA
Japonica Intermediate	241	36.10%	63.10%	0.00%	0.00%	A: 0.83%
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	6.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1119903744	G -> T	LOC_Os11g34050.1	upstream_gene_variant ; 346.0bp to feature; MODIFIER	silent_mutation	Average:48.131; most accessible tissue: Zhenshan97 flag leaf, score: 58.772	N	N	N	N
vg1119903744	G -> T	LOC_Os11g34040-LOC_Os11g34050	intergenic_region ; MODIFIER	silent_mutation	Average:48.131; most accessible tissue: Zhenshan97 flag leaf, score: 58.772	N	N	N	N
vg1119903744	G -> A	LOC_Os11g34050.1	upstream_gene_variant ; 346.0bp to feature; MODIFIER	silent_mutation	Average:48.131; most accessible tissue: Zhenshan97 flag leaf, score: 58.772	N	N	N	N
vg1119903744	G -> A	LOC_Os11g34040-LOC_Os11g34050	intergenic_region ; MODIFIER	silent_mutation	Average:48.131; most accessible tissue: Zhenshan97 flag leaf, score: 58.772	N	N	N	N
vg1119903744	G -> DEL	N	N	silent_mutation	Average:48.131; most accessible tissue: Zhenshan97 flag leaf, score: 58.772	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1119903744	NA	1.34E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119903744	NA	1.01E-06	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119903744	NA	1.94E-06	mr1502	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119903744	NA	1.35E-06	mr1502	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119903744	NA	3.00E-07	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119903744	NA	2.44E-08	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119903744	NA	3.65E-07	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119903744	NA	9.69E-06	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119903744	NA	1.07E-15	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119903744	NA	4.36E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119903744	1.96E-07	1.11E-29	mr1042_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119903744	NA	5.22E-09	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119903744	NA	3.42E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119903744	NA	2.86E-06	mr1269_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119903744	NA	7.91E-07	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119903744	NA	1.89E-08	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119903744	NA	1.90E-11	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119903744	NA	2.88E-08	mr1502_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119903744	NA	2.33E-09	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119903744	NA	8.44E-06	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119903744	NA	1.27E-12	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119903744	4.11E-07	2.90E-20	mr1742_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119903744	NA	3.61E-10	mr1742_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119903744	NA	3.34E-08	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119903744	NA	1.11E-08	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119903744	3.06E-07	1.25E-30	mr1871_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119903744	NA	1.35E-09	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119903744	NA	1.14E-06	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251