\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119890467:

Variant ID: vg1119890467 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 19890467
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


GTGTATGGTGCAGTTGCTATCTAGTAATCGGTAAACTGTCGTGTGCGTAAGCACCGAGAGTATTAATTTGGCTGTTTGAATTAGTATGGTTTTGAGAATT[A/G]
TTTGGTTGATTAGTTTGTTCTAACTGTTAACTACAACTTAACATATATTTTATCTAATTCATGGGACCGGTACGTGCTTATCATGTGTGGTTGCTTACGT

Reverse complement sequence

ACGTAAGCAACCACACATGATAAGCACGTACCGGTCCCATGAATTAGATAAAATATATGTTAAGTTGTAGTTAACAGTTAGAACAAACTAATCAACCAAA[T/C]
AATTCTCAAAACCATACTAATTCAAACAGCCAAATTAATACTCTCGGTGCTTACGCACACGACAGTTTACCGATTACTAGATAGCAACTGCACCATACAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.50% 38.50% 0.04% 0.00% NA
All Indica  2759 88.50% 11.50% 0.07% 0.00% NA
All Japonica  1512 7.50% 92.50% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.30% 1.50% 0.17% 0.00% NA
Indica II  465 95.90% 4.10% 0.00% 0.00% NA
Indica III  913 80.00% 19.90% 0.11% 0.00% NA
Indica Intermediate  786 86.50% 13.50% 0.00% 0.00% NA
Temperate Japonica  767 6.60% 93.40% 0.00% 0.00% NA
Tropical Japonica  504 9.30% 90.70% 0.00% 0.00% NA
Japonica Intermediate  241 6.60% 93.40% 0.00% 0.00% NA
VI/Aromatic  96 32.30% 67.70% 0.00% 0.00% NA
Intermediate  90 56.70% 43.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1119890467 A -> G LOC_Os11g34040.1 upstream_gene_variant ; 3122.0bp to feature; MODIFIER silent_mutation Average:74.243; most accessible tissue: Minghui63 root, score: 96.158 N N N N
vg1119890467 A -> G LOC_Os11g34020-LOC_Os11g34040 intergenic_region ; MODIFIER silent_mutation Average:74.243; most accessible tissue: Minghui63 root, score: 96.158 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1119890467 A G 0.17 -0.02 -0.02 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1119890467 NA 1.50E-83 mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119890467 NA 1.65E-75 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119890467 NA 2.07E-24 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119890467 NA 5.47E-88 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119890467 NA 6.22E-37 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119890467 NA 2.82E-28 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119890467 NA 8.87E-09 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119890467 3.28E-06 6.39E-08 mr1790 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119890467 NA 4.16E-08 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119890467 NA 3.19E-06 mr1510_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119890467 NA 4.94E-06 mr1672_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119890467 NA 1.45E-33 mr1723_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251