\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119869771:

Variant ID: vg1119869771 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 19869771
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCATAAATCAATGGCTAGATATTTCTTATATTTTCTCTAATTTATTAGAGTGCCACATGGCATTATGAGAGCATTTGTAGAATGTCACGTGGCGGCTTGA[A/G]
AGCGTTTGTAGGAAGTTTAATAGATTTTTAGTATATAATAATAGAAGATAGATAGATAGATAGATAGATAGATGCTGGCTGTTGCGCATGTGTATCTGTG

Reverse complement sequence

CACAGATACACATGCGCAACAGCCAGCATCTATCTATCTATCTATCTATCTATCTTCTATTATTATATACTAAAAATCTATTAAACTTCCTACAAACGCT[T/C]
TCAAGCCGCCACGTGACATTCTACAAATGCTCTCATAATGCCATGTGGCACTCTAATAAATTAGAGAAAATATAAGAAATATCTAGCCATTGATTTATGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.90% 10.60% 8.74% 11.74% NA
All Indica  2759 85.80% 0.30% 8.84% 5.00% NA
All Japonica  1512 30.60% 31.70% 10.38% 27.25% NA
Aus  269 98.90% 0.40% 0.74% 0.00% NA
Indica I  595 92.90% 0.30% 6.05% 0.67% NA
Indica II  465 82.80% 0.60% 10.97% 5.59% NA
Indica III  913 85.90% 0.10% 7.78% 6.24% NA
Indica Intermediate  786 82.20% 0.40% 10.94% 6.49% NA
Temperate Japonica  767 23.60% 57.10% 10.56% 8.74% NA
Tropical Japonica  504 43.10% 1.40% 12.30% 43.25% NA
Japonica Intermediate  241 27.00% 14.50% 5.81% 52.70% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 73.30% 10.00% 11.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1119869771 A -> DEL N N silent_mutation Average:39.679; most accessible tissue: Callus, score: 71.91 N N N N
vg1119869771 A -> G LOC_Os11g34000.1 upstream_gene_variant ; 2362.0bp to feature; MODIFIER silent_mutation Average:39.679; most accessible tissue: Callus, score: 71.91 N N N N
vg1119869771 A -> G LOC_Os11g34010.1 upstream_gene_variant ; 3916.0bp to feature; MODIFIER silent_mutation Average:39.679; most accessible tissue: Callus, score: 71.91 N N N N
vg1119869771 A -> G LOC_Os11g33990.1 downstream_gene_variant ; 552.0bp to feature; MODIFIER silent_mutation Average:39.679; most accessible tissue: Callus, score: 71.91 N N N N
vg1119869771 A -> G LOC_Os11g33970.1 intron_variant ; MODIFIER silent_mutation Average:39.679; most accessible tissue: Callus, score: 71.91 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1119869771 NA 1.96E-17 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1119869771 NA 2.54E-17 Heading_date Jap_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1119869771 NA 4.71E-16 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1119869771 NA 2.42E-19 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1119869771 NA 2.33E-14 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1119869771 NA 8.99E-08 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119869771 NA 9.94E-06 mr1271 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119869771 NA 1.08E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119869771 NA 4.18E-10 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119869771 NA 3.91E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119869771 NA 8.81E-07 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119869771 NA 3.78E-07 mr1045_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119869771 NA 7.34E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119869771 NA 2.36E-07 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119869771 NA 8.20E-06 mr1380_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119869771 NA 4.41E-06 mr1517_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119869771 NA 3.47E-06 mr1561_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119869771 NA 9.13E-11 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119869771 NA 1.00E-06 mr1576_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119869771 NA 3.07E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119869771 NA 1.08E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119869771 NA 1.02E-07 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119869771 NA 2.49E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119869771 NA 3.17E-10 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119869771 NA 9.74E-06 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119869771 NA 2.42E-12 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119869771 NA 1.80E-08 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119869771 NA 6.89E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251