| Variant ID: vg1119869771 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 19869771 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GCATAAATCAATGGCTAGATATTTCTTATATTTTCTCTAATTTATTAGAGTGCCACATGGCATTATGAGAGCATTTGTAGAATGTCACGTGGCGGCTTGA[A/G]
AGCGTTTGTAGGAAGTTTAATAGATTTTTAGTATATAATAATAGAAGATAGATAGATAGATAGATAGATAGATGCTGGCTGTTGCGCATGTGTATCTGTG
CACAGATACACATGCGCAACAGCCAGCATCTATCTATCTATCTATCTATCTATCTTCTATTATTATATACTAAAAATCTATTAAACTTCCTACAAACGCT[T/C]
TCAAGCCGCCACGTGACATTCTACAAATGCTCTCATAATGCCATGTGGCACTCTAATAAATTAGAGAAAATATAAGAAATATCTAGCCATTGATTTATGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.90% | 10.60% | 8.74% | 11.74% | NA |
| All Indica | 2759 | 85.80% | 0.30% | 8.84% | 5.00% | NA |
| All Japonica | 1512 | 30.60% | 31.70% | 10.38% | 27.25% | NA |
| Aus | 269 | 98.90% | 0.40% | 0.74% | 0.00% | NA |
| Indica I | 595 | 92.90% | 0.30% | 6.05% | 0.67% | NA |
| Indica II | 465 | 82.80% | 0.60% | 10.97% | 5.59% | NA |
| Indica III | 913 | 85.90% | 0.10% | 7.78% | 6.24% | NA |
| Indica Intermediate | 786 | 82.20% | 0.40% | 10.94% | 6.49% | NA |
| Temperate Japonica | 767 | 23.60% | 57.10% | 10.56% | 8.74% | NA |
| Tropical Japonica | 504 | 43.10% | 1.40% | 12.30% | 43.25% | NA |
| Japonica Intermediate | 241 | 27.00% | 14.50% | 5.81% | 52.70% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 10.00% | 11.11% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1119869771 | A -> DEL | N | N | silent_mutation | Average:39.679; most accessible tissue: Callus, score: 71.91 | N | N | N | N |
| vg1119869771 | A -> G | LOC_Os11g34000.1 | upstream_gene_variant ; 2362.0bp to feature; MODIFIER | silent_mutation | Average:39.679; most accessible tissue: Callus, score: 71.91 | N | N | N | N |
| vg1119869771 | A -> G | LOC_Os11g34010.1 | upstream_gene_variant ; 3916.0bp to feature; MODIFIER | silent_mutation | Average:39.679; most accessible tissue: Callus, score: 71.91 | N | N | N | N |
| vg1119869771 | A -> G | LOC_Os11g33990.1 | downstream_gene_variant ; 552.0bp to feature; MODIFIER | silent_mutation | Average:39.679; most accessible tissue: Callus, score: 71.91 | N | N | N | N |
| vg1119869771 | A -> G | LOC_Os11g33970.1 | intron_variant ; MODIFIER | silent_mutation | Average:39.679; most accessible tissue: Callus, score: 71.91 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1119869771 | NA | 1.96E-17 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1119869771 | NA | 2.54E-17 | Heading_date | Jap_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1119869771 | NA | 4.71E-16 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1119869771 | NA | 2.42E-19 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1119869771 | NA | 2.33E-14 | Spikelet_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1119869771 | NA | 8.99E-08 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119869771 | NA | 9.94E-06 | mr1271 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119869771 | NA | 1.08E-06 | mr1668 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119869771 | NA | 4.18E-10 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119869771 | NA | 3.91E-10 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/