| Variant ID: vg1119865643 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 19865643 |
| Reference Allele: G | Alternative Allele: A,C,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 94. )
CCTGTTGTCTATATTGCTAGATGAATACCTATTATGATTAGTTATTTCATAGATCATTCGTGTAATTCGGAAGCTATGATCATTTTTCTTAAAAATATTT[G/A,C,T]
TTTATCTCCTAGAAAGATCATTTTAAAAGTATCAAGGTCAATTTGTATAGGTACGTAGCTCTCATATGCATGTTAAGAGAAATTAATTAAGTTGGCAGAA
TTCTGCCAACTTAATTAATTTCTCTTAACATGCATATGAGAGCTACGTACCTATACAAATTGACCTTGATACTTTTAAAATGATCTTTCTAGGAGATAAA[C/T,G,A]
AAATATTTTTAAGAAAAATGATCATAGCTTCCGAATTACACGAATGATCTATGAAATAACTAATCATAATAGGTATTCATCTAGCAATATAGACAACAGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.70% | 6.30% | 5.25% | 30.36% | C: 1.93%; T: 0.53% |
| All Indica | 2759 | 46.80% | 9.00% | 7.72% | 32.69% | C: 3.19%; T: 0.62% |
| All Japonica | 1512 | 61.40% | 3.00% | 2.18% | 32.80% | T: 0.46%; C: 0.07% |
| Aus | 269 | 95.20% | 0.00% | 0.00% | 4.46% | T: 0.37% |
| Indica I | 595 | 28.20% | 17.00% | 9.92% | 42.18% | T: 2.69% |
| Indica II | 465 | 71.40% | 4.70% | 5.81% | 18.06% | NA |
| Indica III | 913 | 47.20% | 7.10% | 8.11% | 29.90% | C: 7.67% |
| Indica Intermediate | 786 | 45.80% | 7.60% | 6.74% | 37.40% | C: 2.29%; T: 0.13% |
| Temperate Japonica | 767 | 84.50% | 1.00% | 0.26% | 14.21% | NA |
| Tropical Japonica | 504 | 34.70% | 6.00% | 4.17% | 53.57% | T: 1.39%; C: 0.20% |
| Japonica Intermediate | 241 | 44.00% | 3.30% | 4.15% | 48.55% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 2.20% | 2.22% | 27.78% | C: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1119865643 | G -> T | LOC_Os11g33990.1 | downstream_gene_variant ; 4680.0bp to feature; MODIFIER | silent_mutation | Average:32.083; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg1119865643 | G -> T | LOC_Os11g33970.1 | intron_variant ; MODIFIER | silent_mutation | Average:32.083; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg1119865643 | G -> A | LOC_Os11g33990.1 | downstream_gene_variant ; 4680.0bp to feature; MODIFIER | silent_mutation | Average:32.083; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg1119865643 | G -> A | LOC_Os11g33970.1 | intron_variant ; MODIFIER | silent_mutation | Average:32.083; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg1119865643 | G -> DEL | N | N | silent_mutation | Average:32.083; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg1119865643 | G -> C | LOC_Os11g33990.1 | downstream_gene_variant ; 4680.0bp to feature; MODIFIER | silent_mutation | Average:32.083; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg1119865643 | G -> C | LOC_Os11g33970.1 | intron_variant ; MODIFIER | silent_mutation | Average:32.083; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1119865643 | NA | 2.74E-06 | mr1519 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119865643 | 5.42E-07 | NA | mr1519_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119865643 | 2.28E-07 | 1.58E-10 | mr1519_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |