Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1119756132:

Variant ID: vg1119756132 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 19756132
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTTGAGTTTTTGCTTGCAACGTTTCACCACTCGTCTTATTCAAAATTTTTTGAAATTATTAATTATTTTATTTGTGACTTACTTTATTATCTACAGTA[C/A]
TTTAAACACAACTTTTCGTTTTTTATATTTGCAAAAAAAATTTGAATAAGACGAGTGGTCAAACGTTGCAAGCAAAAACTGAAAATCCCTTATATTGTGG

Reverse complement sequence

CCACAATATAAGGGATTTTCAGTTTTTGCTTGCAACGTTTGACCACTCGTCTTATTCAAATTTTTTTTGCAAATATAAAAAACGAAAAGTTGTGTTTAAA[G/T]
TACTGTAGATAATAAAGTAAGTCACAAATAAAATAATTAATAATTTCAAAAAATTTTGAATAAGACGAGTGGTGAAACGTTGCAAGCAAAAACTCAAAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.40%	17.90%	1.31%	28.35%	NA
All Indica	2759	58.20%	29.20%	1.09%	11.49%	NA
All Japonica	1512	34.00%	1.20%	1.72%	63.10%	NA
Aus	269	96.30%	0.40%	0.74%	2.60%	NA
Indica I	595	73.30%	24.00%	1.34%	1.34%	NA
Indica II	465	71.20%	24.30%	0.43%	4.09%	NA
Indica III	913	43.00%	34.80%	0.66%	21.47%	NA
Indica Intermediate	786	56.70%	29.50%	1.78%	11.96%	NA
Temperate Japonica	767	50.60%	0.70%	1.56%	47.20%	NA
Tropical Japonica	504	11.30%	2.40%	1.39%	84.92%	NA
Japonica Intermediate	241	28.60%	0.40%	2.90%	68.05%	NA
VI/Aromatic	96	52.10%	2.10%	1.04%	44.79%	NA
Intermediate	90	52.20%	23.30%	3.33%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1119756132	C -> A	LOC_Os11g33394.1	upstream_gene_variant ; 416.0bp to feature; MODIFIER	silent_mutation	Average:60.316; most accessible tissue: Zhenshan97 flag leaf, score: 83.994	N	N	N	N
vg1119756132	C -> A	LOC_Os11g33394.2	upstream_gene_variant ; 416.0bp to feature; MODIFIER	silent_mutation	Average:60.316; most accessible tissue: Zhenshan97 flag leaf, score: 83.994	N	N	N	N
vg1119756132	C -> A	LOC_Os11g33380.1	downstream_gene_variant ; 1929.0bp to feature; MODIFIER	silent_mutation	Average:60.316; most accessible tissue: Zhenshan97 flag leaf, score: 83.994	N	N	N	N
vg1119756132	C -> A	LOC_Os11g33380-LOC_Os11g33394	intergenic_region ; MODIFIER	silent_mutation	Average:60.316; most accessible tissue: Zhenshan97 flag leaf, score: 83.994	N	N	N	N
vg1119756132	C -> DEL	N	N	silent_mutation	Average:60.316; most accessible tissue: Zhenshan97 flag leaf, score: 83.994	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1119756132	NA	9.72E-06	mr1152_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119756132	NA	2.87E-06	mr1154_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119756132	6.36E-06	NA	mr1610_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119756132	7.83E-06	NA	mr1904_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251