\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119604110:

Variant ID: vg1119604110 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 19604110
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCCAAAAAGAAACAAGCTTAAAATCCAACTTATGGATCTGTATTTCAAAAAACGAGCAAACTTAACAACCGAATCAAATATGTATGACGTACCAAAACA[A/C]
CAGAAAAACATTTTCAATTTTTATAATACTAGAGACTAATAAAAATCTAAAAATGAATTTCTGTTGCATATTGAATCTAAATAAATGAGAAAATTCATAA

Reverse complement sequence

TTATGAATTTTCTCATTTATTTAGATTCAATATGCAACAGAAATTCATTTTTAGATTTTTATTAGTCTCTAGTATTATAAAAATTGAAAATGTTTTTCTG[T/G]
TGTTTTGGTACGTCATACATATTTGATTCGGTTGTTAAGTTTGCTCGTTTTTTGAAATACAGATCCATAAGTTGGATTTTAAGCTTGTTTCTTTTTGGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.70% 24.10% 0.23% 0.00% NA
All Indica  2759 97.60% 2.40% 0.07% 0.00% NA
All Japonica  1512 39.60% 60.30% 0.07% 0.00% NA
Aus  269 75.80% 21.20% 2.97% 0.00% NA
Indica I  595 98.00% 2.00% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 98.80% 1.10% 0.11% 0.00% NA
Indica Intermediate  786 95.00% 4.80% 0.13% 0.00% NA
Temperate Japonica  767 13.60% 86.30% 0.13% 0.00% NA
Tropical Japonica  504 76.40% 23.60% 0.00% 0.00% NA
Japonica Intermediate  241 45.60% 54.40% 0.00% 0.00% NA
VI/Aromatic  96 21.90% 78.10% 0.00% 0.00% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1119604110 A -> C LOC_Os11g33120-LOC_Os11g33134 intergenic_region ; MODIFIER silent_mutation Average:22.758; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1119604110 NA 3.71E-10 mr1364 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119604110 NA 1.04E-09 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119604110 3.97E-06 NA mr1535 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119604110 NA 1.44E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119604110 NA 3.33E-17 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119604110 NA 1.10E-06 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119604110 NA 1.51E-14 mr1827_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251