\
| Variant ID: vg1119604110 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 19604110 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTCCAAAAAGAAACAAGCTTAAAATCCAACTTATGGATCTGTATTTCAAAAAACGAGCAAACTTAACAACCGAATCAAATATGTATGACGTACCAAAACA[A/C]
CAGAAAAACATTTTCAATTTTTATAATACTAGAGACTAATAAAAATCTAAAAATGAATTTCTGTTGCATATTGAATCTAAATAAATGAGAAAATTCATAA
TTATGAATTTTCTCATTTATTTAGATTCAATATGCAACAGAAATTCATTTTTAGATTTTTATTAGTCTCTAGTATTATAAAAATTGAAAATGTTTTTCTG[T/G]
TGTTTTGGTACGTCATACATATTTGATTCGGTTGTTAAGTTTGCTCGTTTTTTGAAATACAGATCCATAAGTTGGATTTTAAGCTTGTTTCTTTTTGGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.70% | 24.10% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 97.60% | 2.40% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 39.60% | 60.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 75.80% | 21.20% | 2.97% | 0.00% | NA |
| Indica I | 595 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.80% | 1.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.00% | 4.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 13.60% | 86.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 76.40% | 23.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 45.60% | 54.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 21.90% | 78.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 32.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1119604110 | A -> C | LOC_Os11g33120-LOC_Os11g33134 | intergenic_region ; MODIFIER | silent_mutation | Average:22.758; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1119604110 | NA | 3.71E-10 | mr1364 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119604110 | NA | 1.04E-09 | mr1443 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119604110 | 3.97E-06 | NA | mr1535 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119604110 | NA | 1.44E-06 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119604110 | NA | 3.33E-17 | mr1699 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119604110 | NA | 1.10E-06 | mr1653_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119604110 | NA | 1.51E-14 | mr1827_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |