\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119594595:

Variant ID: vg1119594595 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 19594595
Reference Allele: GAAlternative Allele: AA,G
Primary Allele: GASecondary Allele: AA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTCCCGATCCTCACCGACTGGCTCGGCGCTTGCAGCAGCAGCATCTCCAGGTTGTACAGCTGCAAAATCATAAAATTATTATCGGCCATGGTTGCCGGC[GA/AA,G]
CATTGACGGTGACGTCGATTCTGGACCGAAATTGTTTGAGAATTTAGTGAAATTTGACTGAATTTTGAATATATGTACCTCGATGTAGCCGAGGTTGCTG

Reverse complement sequence

CAGCAACCTCGGCTACATCGAGGTACATATATTCAAAATTCAGTCAAATTTCACTAAATTCTCAAACAATTTCGGTCCAGAATCGACGTCACCGTCAATG[TC/TT,C]
GCCGGCAACCATGGCCGATAATAATTTTATGATTTTGCAGCTGTACAACCTGGAGATGCTGCTGCTGCAAGCGCCGAGCCAGTCGGTGAGGATCGGGACG

Allele Frequencies:

Populations Population SizeFrequency of GA(primary allele) Frequency of AA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.00% 5.00% 1.04% 0.00% G: 0.02%
All Indica  2759 99.10% 0.70% 0.14% 0.00% G: 0.04%
All Japonica  1512 83.30% 13.80% 2.91% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.20% 0.40% 0.22% 0.00% G: 0.11%
Indica Intermediate  786 98.50% 1.30% 0.25% 0.00% NA
Temperate Japonica  767 84.60% 11.00% 4.43% 0.00% NA
Tropical Japonica  504 81.70% 17.50% 0.79% 0.00% NA
Japonica Intermediate  241 82.20% 15.40% 2.49% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 92.20% 6.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1119594595 GA -> AA LOC_Os11g33120.1 intron_variant ; MODIFIER silent_mutation Average:90.608; most accessible tissue: Zhenshan97 young leaf, score: 96.823 N N N N
vg1119594595 GA -> AA LOC_Os11g33120.3 intron_variant ; MODIFIER silent_mutation Average:90.608; most accessible tissue: Zhenshan97 young leaf, score: 96.823 N N N N
vg1119594595 GA -> AA LOC_Os11g33120.2 intron_variant ; MODIFIER silent_mutation Average:90.608; most accessible tissue: Zhenshan97 young leaf, score: 96.823 N N N N
vg1119594595 GA -> G LOC_Os11g33120.1 intron_variant ; MODIFIER silent_mutation Average:90.608; most accessible tissue: Zhenshan97 young leaf, score: 96.823 N N N N
vg1119594595 GA -> G LOC_Os11g33120.3 intron_variant ; MODIFIER silent_mutation Average:90.608; most accessible tissue: Zhenshan97 young leaf, score: 96.823 N N N N
vg1119594595 GA -> G LOC_Os11g33120.2 intron_variant ; MODIFIER silent_mutation Average:90.608; most accessible tissue: Zhenshan97 young leaf, score: 96.823 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1119594595 GA AA 0.0 0.0 -0.01 0.0 0.0 0.0
vg1119594595 GA G 0.13 0.1 0.09 0.04 0.09 0.14

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1119594595 7.36E-06 7.73E-07 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119594595 3.54E-07 1.81E-11 mr1790 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251