\
| Variant ID: vg1119581692 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 19581692 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 286. )
TGTGATATAAACATGTGATTGTCACACGTAACTTTAATTAGAATAAACCTTTGTGGTGAGGAGGCCTCTAATTTGGCAGCCCAACATCTGAGAGCTCTCC[C/T]
GATCAACATACCTTTAGCGATGATGCTGGTTACATACTGTCACAATTATATTGTTGCCATGCTATGTATAAATGATGGATCAATGCTTATTGTTTATAAT
ATTATAAACAATAAGCATTGATCCATCATTTATACATAGCATGGCAACAATATAATTGTGACAGTATGTAACCAGCATCATCGCTAAAGGTATGTTGATC[G/A]
GGAGAGCTCTCAGATGTTGGGCTGCCAAATTAGAGGCCTCCTCACCACAAAGGTTTATTCTAATTAAAGTTACGTGTGACAATCACATGTTTATATCACA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.90% | 1.80% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.20% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 94.00% | 5.20% | 0.73% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 97.30% | 1.80% | 0.91% | 0.00% | NA |
| Tropical Japonica | 504 | 93.10% | 6.70% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.90% | 12.90% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1119581692 | C -> T | LOC_Os11g33110.1 | upstream_gene_variant ; 3975.0bp to feature; MODIFIER | silent_mutation | Average:64.181; most accessible tissue: Callus, score: 82.87 | N | N | N | N |
| vg1119581692 | C -> T | LOC_Os11g33100.1 | intron_variant ; MODIFIER | silent_mutation | Average:64.181; most accessible tissue: Callus, score: 82.87 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1119581692 | NA | 3.43E-06 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119581692 | 2.03E-07 | NA | mr1679 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119581692 | NA | 1.06E-06 | mr1720 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119581692 | 8.93E-06 | NA | mr1079_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119581692 | 4.49E-07 | 1.35E-08 | mr1113_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119581692 | NA | 8.42E-07 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119581692 | NA | 5.01E-06 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119581692 | NA | 9.14E-06 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119581692 | NA | 8.91E-07 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119581692 | NA | 2.16E-08 | mr1750_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |