Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119579328:

Variant ID: vg1119579328 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 19579328
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAAACTCGACTTTAAGATAAGGAACCTAAAGTGAACTTATTCAAAGAAAAGGGAAAACATACCGTAACATTGGGGGGCGCCTAGCTGGCGCGTATGCGCC[G/A]
CTAGCGCGCACCTTCCCCATCTAACCACCTATACTAGTATTAGTTAACATTACTTAACACTAATAACAATAATTAGGAAAGATTTTAAAGATTTTTTTGG

Reverse complement sequence

CCAAAAAAATCTTTAAAATCTTTCCTAATTATTGTTATTAGTGTTAAGTAATGTTAACTAATACTAGTATAGGTGGTTAGATGGGGAAGGTGCGCGCTAG[C/T]
GGCGCATACGCGCCAGCTAGGCGCCCCCCAATGTTACGGTATGTTTTCCCTTTTCTTTGAATAAGTTCACTTTAGGTTCCTTATCTTAAAGTCGAGTTTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.00%	10.90%	0.04%	0.00%	NA
All Indica	2759	98.50%	1.40%	0.04%	0.00%	NA
All Japonica	1512	68.80%	31.20%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	96.50%	3.40%	0.11%	0.00%	NA
Indica Intermediate	786	99.10%	0.90%	0.00%	0.00%	NA
Temperate Japonica	767	93.40%	6.60%	0.00%	0.00%	NA
Tropical Japonica	504	36.50%	63.50%	0.00%	0.00%	NA
Japonica Intermediate	241	58.50%	41.50%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	6.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1119579328	G -> A	LOC_Os11g33090.1	upstream_gene_variant ; 2789.0bp to feature; MODIFIER	silent_mutation	Average:65.834; most accessible tissue: Zhenshan97 panicle, score: 80.486	N	N	N	N
vg1119579328	G -> A	LOC_Os11g33100.1	upstream_gene_variant ; 978.0bp to feature; MODIFIER	silent_mutation	Average:65.834; most accessible tissue: Zhenshan97 panicle, score: 80.486	N	N	N	N
vg1119579328	G -> A	LOC_Os11g33090-LOC_Os11g33100	intergenic_region ; MODIFIER	silent_mutation	Average:65.834; most accessible tissue: Zhenshan97 panicle, score: 80.486	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1119579328	3.04E-07	3.69E-08	mr1502	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579328	NA	7.10E-08	mr1502	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579328	4.66E-07	2.70E-09	mr1543	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579328	NA	2.59E-08	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579328	NA	5.73E-06	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579328	NA	1.06E-08	mr1642	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579328	NA	8.24E-06	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579328	NA	6.48E-28	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579328	2.21E-10	1.18E-21	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579328	NA	2.51E-08	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579328	1.38E-09	4.35E-26	mr1042_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579328	NA	2.14E-08	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579328	NA	1.65E-10	mr1471_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579328	NA	1.94E-09	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579328	4.37E-07	1.17E-11	mr1543_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579328	NA	5.19E-09	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579328	NA	3.01E-08	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579328	NA	3.66E-09	mr1642_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579328	NA	3.91E-10	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579328	2.69E-10	2.78E-21	mr1742_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579328	2.87E-06	3.96E-12	mr1742_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579328	4.90E-11	7.13E-30	mr1871_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579328	NA	1.10E-09	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251