Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119577611:

Variant ID: vg1119577611 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 19577611
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:


CCAAGACAACATGCAGCAGCAGCAATTGGATTACGCATGCAAGCAAAATGTGATCATATTATAGTAGTACATCTTATTATTGTACAAAATAATTTTAACT[C/T]
AAACCGTATTTGAGGCGGCATGTTTTAGAGTTATCAGCTGGCTGTATCATTGAACTTGCTCTTAGCCTATTTTCTAACCTTTGAGCTTCGAGCCAGTTTC

Reverse complement sequence

GAAACTGGCTCGAAGCTCAAAGGTTAGAAAATAGGCTAAGAGCAAGTTCAATGATACAGCCAGCTGATAACTCTAAAACATGCCGCCTCAAATACGGTTT[G/A]
AGTTAAAATTATTTTGTACAATAATAAGATGTACTACTATAATATGATCACATTTTGCTTGCATGCGTAATCCAATTGCTGCTGCTGCATGTTGTCTTGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.90% 11.00% 0.02% 0.00% NA
All Indica  2759 98.50% 1.50% 0.00% 0.00% NA
All Japonica  1512 68.70% 31.30% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 96.50% 3.50% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.90% 0.00% 0.00% NA
Temperate Japonica  767 93.20% 6.80% 0.00% 0.00% NA
Tropical Japonica  504 36.30% 63.70% 0.00% 0.00% NA
Japonica Intermediate  241 58.10% 41.90% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1119577611 C -> T LOC_Os11g33090.1 upstream_gene_variant ; 1072.0bp to feature; MODIFIER silent_mutation Average:64.762; most accessible tissue: Callus, score: 96.412 N N N N
vg1119577611 C -> T LOC_Os11g33100.1 upstream_gene_variant ; 2695.0bp to feature; MODIFIER silent_mutation Average:64.762; most accessible tissue: Callus, score: 96.412 N N N N
vg1119577611 C -> T LOC_Os11g33090-LOC_Os11g33100 intergenic_region ; MODIFIER silent_mutation Average:64.762; most accessible tissue: Callus, score: 96.412 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1119577611 NA 9.65E-07 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119577611 NA 2.86E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119577611 8.34E-06 4.41E-08 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119577611 NA 4.47E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119577611 NA 2.41E-07 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119577611 NA 2.19E-28 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119577611 3.33E-11 1.44E-22 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119577611 NA 8.91E-09 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119577611 9.72E-09 2.00E-24 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119577611 NA 2.46E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119577611 NA 4.39E-08 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119577611 4.23E-06 5.37E-10 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119577611 4.05E-09 4.75E-19 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119577611 9.79E-06 2.28E-10 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119577611 2.43E-11 4.11E-29 mr1871_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119577611 NA 3.37E-09 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251