Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119521782:

Variant ID: vg1119521782 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 19521782
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

TGTAACGGGCTATAGTTTGACTGGTCGTCTGGGTCAAAGCTATCGGTGACGGGCTTTACTTAGGGCCCGATTGAGATATATTCATTCGTGACGGCTGTTT[G/A]
CCCGATTGAGATAACTCTTCACATCAGTGACTTCTAGCCTGTGACGGACGCTGTGCCCGATTGAGATGAGGGTATCCGTTCTAGTGAGTGTCTTTTTTTT

Reverse complement sequence

AAAAAAAAGACACTCACTAGAACGGATACCCTCATCTCAATCGGGCACAGCGTCCGTCACAGGCTAGAAGTCACTGATGTGAAGAGTTATCTCAATCGGG[C/T]
AAACAGCCGTCACGAATGAATATATCTCAATCGGGCCCTAAGTAAAGCCCGTCACCGATAGCTTTGACCCAGACGACCAGTCAAACTATAGCCCGTTACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.20%	7.10%	1.67%	49.03%	NA
All Indica	2759	11.80%	7.50%	2.43%	78.25%	NA
All Japonica	1512	89.60%	7.60%	0.13%	2.71%	NA
Aus	269	72.50%	0.00%	3.72%	23.79%	NA
Indica I	595	12.90%	4.20%	1.51%	81.34%	NA
Indica II	465	6.90%	22.40%	2.37%	68.39%	NA
Indica III	913	11.80%	1.30%	3.18%	83.68%	NA
Indica Intermediate	786	13.90%	8.40%	2.29%	75.45%	NA
Temperate Japonica	767	94.30%	2.30%	0.13%	3.26%	NA
Tropical Japonica	504	88.10%	9.30%	0.00%	2.58%	NA
Japonica Intermediate	241	77.60%	20.70%	0.41%	1.24%	NA
VI/Aromatic	96	78.10%	0.00%	0.00%	21.88%	NA
Intermediate	90	50.00%	14.40%	0.00%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1119521782	G -> A	LOC_Os11g33030.1	upstream_gene_variant ; 2000.0bp to feature; MODIFIER	silent_mutation	Average:23.476; most accessible tissue: Callus, score: 50.178	N	N	N	N
vg1119521782	G -> A	LOC_Os11g33020.1	downstream_gene_variant ; 750.0bp to feature; MODIFIER	silent_mutation	Average:23.476; most accessible tissue: Callus, score: 50.178	N	N	N	N
vg1119521782	G -> A	LOC_Os11g33020-LOC_Os11g33030	intergenic_region ; MODIFIER	silent_mutation	Average:23.476; most accessible tissue: Callus, score: 50.178	N	N	N	N
vg1119521782	G -> DEL	N	N	silent_mutation	Average:23.476; most accessible tissue: Callus, score: 50.178	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1119521782	4.88E-06	4.88E-06	mr1025	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119521782	NA	9.23E-06	mr1044	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119521782	2.74E-06	2.74E-06	mr1159	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119521782	2.61E-06	2.61E-06	mr1463	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119521782	NA	1.24E-06	mr1648	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119521782	NA	1.52E-06	mr1842_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119521782	NA	1.82E-07	mr1933_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251