Variant ID: vg1119520666 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 19520666 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CCCAATTCAACTAGCGATAGATGAAGCGTGGGCCCAATACGTGCAAAGAGGAGGCCTCAGGAAGACAGGACATGACACCCTCATCCACAAAAAAGACTTC[T/C]
CGGTGAAGCAACAAATAGGTGACCAGTGCGGATTCCATGTGTGCCACAATATGCGACTTCTGTATAGAGAAAAGGTGAAGACTTTGGCTGAGTTTGAGGT
ACCTCAAACTCAGCCAAAGTCTTCACCTTTTCTCTATACAGAAGTCGCATATTGTGGCACACATGGAATCCGCACTGGTCACCTATTTGTTGCTTCACCG[A/G]
GAAGTCTTTTTTGTGGATGAGGGTGTCATGTCCTGTCTTCCTGAGGCCTCCTCTTTGCACGTATTGGGCCCACGCTTCATCTATCGCTAGTTGAATTGGG
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 35.90% | 0.20% | 13.03% | 50.85% | NA |
All Indica | 2759 | 7.30% | 0.10% | 11.89% | 80.72% | NA |
All Japonica | 1512 | 89.40% | 0.30% | 7.54% | 2.71% | NA |
Aus | 269 | 11.50% | 1.10% | 57.25% | 30.11% | NA |
Indica I | 595 | 8.40% | 0.00% | 8.24% | 83.36% | NA |
Indica II | 465 | 5.20% | 0.40% | 24.09% | 70.32% | NA |
Indica III | 913 | 6.10% | 0.00% | 7.34% | 86.53% | NA |
Indica Intermediate | 786 | 9.00% | 0.10% | 12.72% | 78.12% | NA |
Temperate Japonica | 767 | 94.00% | 0.00% | 2.61% | 3.39% | NA |
Tropical Japonica | 504 | 88.50% | 0.40% | 8.73% | 2.38% | NA |
Japonica Intermediate | 241 | 76.80% | 1.20% | 20.75% | 1.24% | NA |
VI/Aromatic | 96 | 78.10% | 0.00% | 0.00% | 21.88% | NA |
Intermediate | 90 | 41.10% | 0.00% | 22.22% | 36.67% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1119520666 | T -> DEL | LOC_Os11g33020.1 | N | frameshift_variant | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
vg1119520666 | T -> C | LOC_Os11g33020.1 | missense_variant ; p.Ser664Pro; MODERATE | nonsynonymous_codon ; S664P | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | benign | -0.412 | TOLERATED | 1.00 |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1119520666 | NA | 7.79E-06 | mr1209 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1119520666 | NA | 1.82E-06 | mr1230 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1119520666 | 5.90E-06 | NA | mr1533 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1119520666 | NA | 6.72E-06 | mr1564 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1119520666 | NA | 1.47E-06 | mr1791 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1119520666 | NA | 9.60E-08 | mr1884 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1119520666 | 2.12E-06 | NA | mr1980 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |