\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119511373:

Variant ID: vg1119511373 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 19511373
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


GGCCGTCACAAGGAAGTAATCTCAATCGGGCCAAAGTTTCGCCCGATTGAGATATGGTCGCACAGCCATGGTATATCGGCACAAAACTAAAGCCCGTCAC[G/A]
GATGACACTTATCTGTGACGGGCTATAGTTGAGGCCCGATTGAGATGAGGGTTCCATATCTCAATCGGGCCCTAAAAGAAGCCCGTCACAGATGAGGGTC

Reverse complement sequence

GACCCTCATCTGTGACGGGCTTCTTTTAGGGCCCGATTGAGATATGGAACCCTCATCTCAATCGGGCCTCAACTATAGCCCGTCACAGATAAGTGTCATC[C/T]
GTGACGGGCTTTAGTTTTGTGCCGATATACCATGGCTGTGCGACCATATCTCAATCGGGCGAAACTTTGGCCCGATTGAGATTACTTCCTTGTGACGGCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.60% 12.40% 13.20% 1.71% NA
All Indica  2759 67.30% 11.30% 20.51% 0.87% NA
All Japonica  1512 89.50% 8.30% 0.79% 1.46% NA
Aus  269 32.30% 48.00% 7.81% 11.90% NA
Indica I  595 62.70% 7.90% 29.08% 0.34% NA
Indica II  465 71.00% 22.80% 5.81% 0.43% NA
Indica III  913 69.60% 6.00% 23.44% 0.99% NA
Indica Intermediate  786 66.20% 13.10% 19.34% 1.40% NA
Temperate Japonica  767 94.30% 2.60% 0.78% 2.35% NA
Tropical Japonica  504 88.90% 9.70% 0.60% 0.79% NA
Japonica Intermediate  241 75.50% 23.20% 1.24% 0.00% NA
VI/Aromatic  96 75.00% 4.20% 17.71% 3.12% NA
Intermediate  90 70.00% 21.10% 8.89% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1119511373 G -> A LOC_Os11g33010.1 upstream_gene_variant ; 847.0bp to feature; MODIFIER silent_mutation Average:16.751; most accessible tissue: Minghui63 root, score: 27.443 N N N N
vg1119511373 G -> A LOC_Os11g33000.1 downstream_gene_variant ; 1450.0bp to feature; MODIFIER silent_mutation Average:16.751; most accessible tissue: Minghui63 root, score: 27.443 N N N N
vg1119511373 G -> A LOC_Os11g33000-LOC_Os11g33010 intergenic_region ; MODIFIER silent_mutation Average:16.751; most accessible tissue: Minghui63 root, score: 27.443 N N N N
vg1119511373 G -> DEL N N silent_mutation Average:16.751; most accessible tissue: Minghui63 root, score: 27.443 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1119511373 NA 5.48E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119511373 NA 9.58E-06 mr1048 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119511373 NA 1.51E-06 mr1196 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119511373 4.77E-06 NA mr1217 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119511373 NA 3.93E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119511373 2.97E-06 2.97E-06 mr1463 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119511373 NA 3.83E-06 mr1483 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119511373 NA 4.63E-07 mr1523 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119511373 NA 3.71E-06 mr1648 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119511373 8.47E-07 8.47E-07 mr1655 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119511373 9.17E-07 5.24E-08 mr1666 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119511373 NA 1.78E-06 mr1712 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119511373 2.18E-07 2.18E-07 mr1761 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119511373 2.02E-06 2.02E-06 mr1770 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119511373 NA 9.52E-06 mr1837 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119511373 8.35E-06 8.35E-06 mr1876 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119511373 NA 2.74E-06 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251