Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119510114:

Variant ID: vg1119510114 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 19510114
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

CCCTGTTCCCCCAGAGATGTCTCATTAACATATCCCTATTTGATTAACGTTGTGGTTGTTTCAAAACGTATGGGTGATAAGTGGTAATAGTGTACTTCTG[G/A]
CATTTTTTGGGGGGGGTACTTCTGGCATAATTGATAATAAGTGGTGGAGGTTTGTGAAGATAAGAGTTGGAAACACAGATGGAAAGAGAAGAGTTGTGTT

Reverse complement sequence

AACACAACTCTTCTCTTTCCATCTGTGTTTCCAACTCTTATCTTCACAAACCTCCACCACTTATTATCAATTATGCCAGAAGTACCCCCCCCAAAAAATG[C/T]
CAGAAGTACACTATTACCACTTATCACCCATACGTTTTGAAACAACCACAACGTTAATCAAATAGGGATATGTTAATGAGACATCTCTGGGGGAACAGGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.60%	7.00%	20.10%	4.36%	NA
All Indica	2759	56.10%	7.20%	31.53%	5.07%	NA
All Japonica	1512	90.10%	7.70%	0.86%	1.32%	NA
Aus	269	68.00%	0.00%	17.47%	14.50%	NA
Indica I	595	53.40%	4.40%	36.97%	5.21%	NA
Indica II	465	33.50%	22.20%	36.77%	7.53%	NA
Indica III	913	68.60%	1.10%	26.07%	4.27%	NA
Indica Intermediate	786	57.10%	7.80%	30.66%	4.45%	NA
Temperate Japonica	767	95.00%	2.30%	0.13%	2.48%	NA
Tropical Japonica	504	88.70%	9.30%	1.79%	0.20%	NA
Japonica Intermediate	241	77.60%	21.20%	1.24%	0.00%	NA
VI/Aromatic	96	94.80%	0.00%	5.21%	0.00%	NA
Intermediate	90	61.10%	14.40%	16.67%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1119510114	G -> A	LOC_Os11g33010.1	upstream_gene_variant ; 2106.0bp to feature; MODIFIER	silent_mutation	Average:58.263; most accessible tissue: Zhenshan97 flower, score: 80.006	N	N	N	N
vg1119510114	G -> A	LOC_Os11g33000.1	downstream_gene_variant ; 191.0bp to feature; MODIFIER	silent_mutation	Average:58.263; most accessible tissue: Zhenshan97 flower, score: 80.006	N	N	N	N
vg1119510114	G -> A	LOC_Os11g33000-LOC_Os11g33010	intergenic_region ; MODIFIER	silent_mutation	Average:58.263; most accessible tissue: Zhenshan97 flower, score: 80.006	N	N	N	N
vg1119510114	G -> DEL	N	N	silent_mutation	Average:58.263; most accessible tissue: Zhenshan97 flower, score: 80.006	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1119510114	NA	2.12E-06	mr1648	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119510114	8.47E-07	8.47E-07	mr1655	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119510114	1.81E-06	NA	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119510114	NA	1.78E-06	mr1712	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119510114	2.18E-07	2.18E-07	mr1761	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119510114	2.02E-06	2.02E-06	mr1770	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119510114	NA	4.04E-06	mr1830	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119510114	8.35E-06	8.35E-06	mr1876	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119510114	NA	2.74E-06	mr1961	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251