RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1119431785:

Variant ID: vg1119431785 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 19431785
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATATGTTTAGAGTTTAGACACTTCATTAGTTGCGGGATATATTTATTCCTCCGTGGAGATGCATATTTTTTCCTTTCGATTAAAAAATATATATACTTCT[T/C]
CATTCTATAATATAAGACGCACATGTGTTTTAGGATTGAACTTTTAAATTATTTAACAAAAAAAATACTATAATATAAATTGAATTTTATTTGCTAAAAG

Reverse complement sequence

CTTTTAGCAAATAAAATTCAATTTATATTATAGTATTTTTTTTGTTAAATAATTTAAAAGTTCAATCCTAAAACACATGTGCGTCTTATATTATAGAATG[A/G]
AGAAGTATATATATTTTTTAATCGAAAGGAAAAAATATGCATCTCCACGGAGGAATAAATATATCCCGCAACTAATGAAGTGTCTAAACTCTAAACATAT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.20%	31.60%	0.06%	1.12%	NA
All Indica	2759	98.70%	0.90%	0.04%	0.36%	NA
All Japonica	1512	9.30%	90.60%	0.13%	0.00%	NA
Aus	269	83.60%	0.40%	0.00%	15.99%	NA
Indica I	595	98.80%	1.20%	0.00%	0.00%	NA
Indica II	465	99.40%	0.40%	0.00%	0.22%	NA
Indica III	913	99.50%	0.30%	0.00%	0.22%	NA
Indica Intermediate	786	97.20%	1.80%	0.13%	0.89%	NA
Temperate Japonica	767	6.10%	93.90%	0.00%	0.00%	NA
Tropical Japonica	504	11.10%	88.50%	0.40%	0.00%	NA
Japonica Intermediate	241	15.40%	84.60%	0.00%	0.00%	NA
VI/Aromatic	96	31.20%	68.80%	0.00%	0.00%	NA
Intermediate	90	66.70%	33.30%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1119431785	T -> DEL	N	N	silent_mutation	Average:46.187; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg1119431785	T -> C	LOC_Os11g32880.1	upstream_gene_variant ; 2120.0bp to feature; MODIFIER	silent_mutation	Average:46.187; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg1119431785	T -> C	LOC_Os11g32890.1	upstream_gene_variant ; 627.0bp to feature; MODIFIER	silent_mutation	Average:46.187; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg1119431785	T -> C	LOC_Os11g32900.1	upstream_gene_variant ; 1669.0bp to feature; MODIFIER	silent_mutation	Average:46.187; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg1119431785	T -> C	LOC_Os11g32880.2	upstream_gene_variant ; 2120.0bp to feature; MODIFIER	silent_mutation	Average:46.187; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg1119431785	T -> C	LOC_Os11g32880.3	upstream_gene_variant ; 2120.0bp to feature; MODIFIER	silent_mutation	Average:46.187; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg1119431785	T -> C	LOC_Os11g32900.2	upstream_gene_variant ; 1671.0bp to feature; MODIFIER	silent_mutation	Average:46.187; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg1119431785	T -> C	LOC_Os11g32890-LOC_Os11g32900	intergenic_region ; MODIFIER	silent_mutation	Average:46.187; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N

Showing 1 to 8 of 8 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1119431785	NA	1.21E-106	mr1008	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119431785	NA	1.83E-106	mr1009	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119431785	NA	1.40E-71	mr1014	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119431785	NA	1.16E-57	mr1019	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119431785	6.26E-07	NA	mr1023	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119431785	NA	1.15E-26	mr1024	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119431785	NA	2.51E-67	mr1027	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119431785	NA	8.11E-06	mr1066	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119431785	NA	1.68E-10	mr1070	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119431785	NA	6.27E-32	mr1074	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 101 entries

Previous1 2 3 4 5…11Next

Search for Variation information by Variation ID:

Detailed information for vg1119431785:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact