Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119404698:

Variant ID: vg1119404698 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 19404698
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

TCGATGTTCGATGCAATATCGTTATATATGGGAGTTTTGATGAAAATGGGCAAAGAACCTATATTGATAAACTGTAGAGAGTGAGAGGAGTCGTTATACC[G/A]
GTTTTGTAGTTGAGTGTTATCCGACCCATATTTGAGGGATGCAAACTGGACTTTCCTTTGACCGTACATATGCAGTAGAATTTTAGAAATTTTTTCATTT

Reverse complement sequence

AAATGAAAAAATTTCTAAAATTCTACTGCATATGTACGGTCAAAGGAAAGTCCAGTTTGCATCCCTCAAATATGGGTCGGATAACACTCAACTACAAAAC[C/T]
GGTATAACGACTCCTCTCACTCTCTACAGTTTATCAATATAGGTTCTTTGCCCATTTTCATCAAAACTCCCATATATAACGATATTGCATCGAACATCGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.40%	37.30%	0.30%	0.00%	NA
All Indica	2759	93.10%	6.40%	0.43%	0.00%	NA
All Japonica	1512	7.30%	92.70%	0.00%	0.00%	NA
Aus	269	78.10%	21.90%	0.00%	0.00%	NA
Indica I	595	96.30%	3.50%	0.17%	0.00%	NA
Indica II	465	90.50%	8.60%	0.86%	0.00%	NA
Indica III	913	95.80%	3.90%	0.22%	0.00%	NA
Indica Intermediate	786	89.20%	10.20%	0.64%	0.00%	NA
Temperate Japonica	767	3.70%	96.30%	0.00%	0.00%	NA
Tropical Japonica	504	10.70%	89.30%	0.00%	0.00%	NA
Japonica Intermediate	241	11.60%	88.40%	0.00%	0.00%	NA
VI/Aromatic	96	8.30%	91.70%	0.00%	0.00%	NA
Intermediate	90	58.90%	38.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1119404698	G -> A	LOC_Os11g32850.1	upstream_gene_variant ; 758.0bp to feature; MODIFIER	silent_mutation	Average:41.43; most accessible tissue: Zhenshan97 young leaf, score: 61.964	N	N	N	N
vg1119404698	G -> A	LOC_Os11g32840.1	downstream_gene_variant ; 978.0bp to feature; MODIFIER	silent_mutation	Average:41.43; most accessible tissue: Zhenshan97 young leaf, score: 61.964	N	N	N	N
vg1119404698	G -> A	LOC_Os11g32840-LOC_Os11g32850	intergenic_region ; MODIFIER	silent_mutation	Average:41.43; most accessible tissue: Zhenshan97 young leaf, score: 61.964	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1119404698	NA	6.36E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119404698	NA	5.25E-06	mr1227_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119404698	NA	3.21E-08	mr1354_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119404698	2.82E-06	2.82E-06	mr1413_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119404698	NA	8.93E-08	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119404698	NA	1.25E-07	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251