\
| Variant ID: vg1119398753 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr11 | Position: 19398753 |
| Reference Allele: C | Alternative Allele: T,CGGT |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGCATTTGAGCACTGACATTTTGAGAGAGTGGAAAATAGTAAATTCCCCCGGCAGTATGTAGATGCTAGAAACGAGAGGGCTCACCGAGTTAGCTTAAAA[C/T,CGGT]
GGCGAGATGCGGCCGGAAAAACTTCACGGCGGCAGAAACAGGGCACGGCGGTGGCGGCGGAGCTCGGTCGAACGCAGCAAGGTGAAAGTCATCGCAGAGC
GCTCTGCGATGACTTTCACCTTGCTGCGTTCGACCGAGCTCCGCCGCCACCGCCGTGCCCTGTTTCTGCCGCCGTGAAGTTTTTCCGGCCGCATCTCGCC[G/A,ACCG]
TTTTAAGCTAACTCGGTGAGCCCTCTCGTTTCTAGCATCTACATACTGCCGGGGGAATTTACTATTTTCCACTCTCTCAAAATGTCAGTGCTCAAATGCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.50% | 3.90% | 3.77% | 51.54% | CGGT: 0.32% |
| All Indica | 2759 | 11.00% | 6.30% | 5.94% | 76.40% | CGGT: 0.36% |
| All Japonica | 1512 | 93.10% | 0.10% | 0.40% | 6.35% | CGGT: 0.07% |
| Aus | 269 | 27.90% | 3.30% | 1.86% | 66.54% | CGGT: 0.37% |
| Indica I | 595 | 4.70% | 0.50% | 2.02% | 92.77% | NA |
| Indica II | 465 | 19.10% | 7.50% | 3.44% | 69.89% | NA |
| Indica III | 913 | 7.70% | 11.00% | 10.19% | 71.08% | CGGT: 0.11% |
| Indica Intermediate | 786 | 14.80% | 4.60% | 5.47% | 74.05% | CGGT: 1.15% |
| Temperate Japonica | 767 | 96.50% | 0.30% | 0.26% | 3.00% | NA |
| Tropical Japonica | 504 | 89.70% | 0.00% | 0.20% | 10.12% | NA |
| Japonica Intermediate | 241 | 89.20% | 0.00% | 1.24% | 9.13% | CGGT: 0.41% |
| VI/Aromatic | 96 | 91.70% | 0.00% | 2.08% | 3.12% | CGGT: 3.12% |
| Intermediate | 90 | 43.30% | 0.00% | 1.11% | 55.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1119398753 | C -> CGGT | LOC_Os11g32840.1 | upstream_gene_variant ; 4637.0bp to feature; MODIFIER | silent_mutation | Average:32.61; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg1119398753 | C -> CGGT | LOC_Os11g32830.1 | downstream_gene_variant ; 4051.0bp to feature; MODIFIER | silent_mutation | Average:32.61; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg1119398753 | C -> CGGT | LOC_Os11g32830-LOC_Os11g32840 | intergenic_region ; MODIFIER | silent_mutation | Average:32.61; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg1119398753 | C -> T | LOC_Os11g32840.1 | upstream_gene_variant ; 4638.0bp to feature; MODIFIER | silent_mutation | Average:32.61; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg1119398753 | C -> T | LOC_Os11g32830.1 | downstream_gene_variant ; 4050.0bp to feature; MODIFIER | silent_mutation | Average:32.61; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg1119398753 | C -> T | LOC_Os11g32830-LOC_Os11g32840 | intergenic_region ; MODIFIER | silent_mutation | Average:32.61; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg1119398753 | C -> DEL | N | N | silent_mutation | Average:32.61; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1119398753 | NA | 3.07E-07 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119398753 | 4.99E-06 | 5.85E-07 | mr1227_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119398753 | NA | 2.39E-07 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119398753 | NA | 1.90E-06 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119398753 | NA | 7.00E-09 | mr1783_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119398753 | NA | 2.74E-06 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119398753 | NA | 5.58E-08 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119398753 | NA | 5.34E-09 | mr1947_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |