\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119398753:

Variant ID: vg1119398753 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 19398753
Reference Allele: CAlternative Allele: T,CGGT
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCATTTGAGCACTGACATTTTGAGAGAGTGGAAAATAGTAAATTCCCCCGGCAGTATGTAGATGCTAGAAACGAGAGGGCTCACCGAGTTAGCTTAAAA[C/T,CGGT]
GGCGAGATGCGGCCGGAAAAACTTCACGGCGGCAGAAACAGGGCACGGCGGTGGCGGCGGAGCTCGGTCGAACGCAGCAAGGTGAAAGTCATCGCAGAGC

Reverse complement sequence

GCTCTGCGATGACTTTCACCTTGCTGCGTTCGACCGAGCTCCGCCGCCACCGCCGTGCCCTGTTTCTGCCGCCGTGAAGTTTTTCCGGCCGCATCTCGCC[G/A,ACCG]
TTTTAAGCTAACTCGGTGAGCCCTCTCGTTTCTAGCATCTACATACTGCCGGGGGAATTTACTATTTTCCACTCTCTCAAAATGTCAGTGCTCAAATGCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.50% 3.90% 3.77% 51.54% CGGT: 0.32%
All Indica  2759 11.00% 6.30% 5.94% 76.40% CGGT: 0.36%
All Japonica  1512 93.10% 0.10% 0.40% 6.35% CGGT: 0.07%
Aus  269 27.90% 3.30% 1.86% 66.54% CGGT: 0.37%
Indica I  595 4.70% 0.50% 2.02% 92.77% NA
Indica II  465 19.10% 7.50% 3.44% 69.89% NA
Indica III  913 7.70% 11.00% 10.19% 71.08% CGGT: 0.11%
Indica Intermediate  786 14.80% 4.60% 5.47% 74.05% CGGT: 1.15%
Temperate Japonica  767 96.50% 0.30% 0.26% 3.00% NA
Tropical Japonica  504 89.70% 0.00% 0.20% 10.12% NA
Japonica Intermediate  241 89.20% 0.00% 1.24% 9.13% CGGT: 0.41%
VI/Aromatic  96 91.70% 0.00% 2.08% 3.12% CGGT: 3.12%
Intermediate  90 43.30% 0.00% 1.11% 55.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1119398753 C -> CGGT LOC_Os11g32840.1 upstream_gene_variant ; 4637.0bp to feature; MODIFIER silent_mutation Average:32.61; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg1119398753 C -> CGGT LOC_Os11g32830.1 downstream_gene_variant ; 4051.0bp to feature; MODIFIER silent_mutation Average:32.61; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg1119398753 C -> CGGT LOC_Os11g32830-LOC_Os11g32840 intergenic_region ; MODIFIER silent_mutation Average:32.61; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg1119398753 C -> T LOC_Os11g32840.1 upstream_gene_variant ; 4638.0bp to feature; MODIFIER silent_mutation Average:32.61; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg1119398753 C -> T LOC_Os11g32830.1 downstream_gene_variant ; 4050.0bp to feature; MODIFIER silent_mutation Average:32.61; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg1119398753 C -> T LOC_Os11g32830-LOC_Os11g32840 intergenic_region ; MODIFIER silent_mutation Average:32.61; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg1119398753 C -> DEL N N silent_mutation Average:32.61; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1119398753 NA 3.07E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119398753 4.99E-06 5.85E-07 mr1227_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119398753 NA 2.39E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119398753 NA 1.90E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119398753 NA 7.00E-09 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119398753 NA 2.74E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119398753 NA 5.58E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119398753 NA 5.34E-09 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251