\
| Variant ID: vg1119397311 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 19397311 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACACCATGTCATCTCGATCAGGGTTTATAAACATAATATAATCATAATTGAGCTCATCAATCCAATTACTTGTACATGGTAATGGTATAAATTGCCATGC[G/A]
CGGCATATAGTTGCCTCCTGCTCGAGGACTTAAAAACAAGAACCACTATATAGAGGTACCACATTGTTAAATAACATAATAACTAGGTCTGTCCCCACTC
GAGTGGGGACAGACCTAGTTATTATGTTATTTAACAATGTGGTACCTCTATATAGTGGTTCTTGTTTTTAAGTCCTCGAGCAGGAGGCAACTATATGCCG[C/T]
GCATGGCAATTTATACCATTACCATGTACAAGTAATTGGATTGATGAGCTCAATTATGATTATATTATGTTTATAAACCCTGATCGAGATGACATGGTGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 28.90% | 8.30% | 3.26% | 59.56% | NA |
| All Indica | 2759 | 6.30% | 0.30% | 4.28% | 89.05% | NA |
| All Japonica | 1512 | 66.80% | 24.90% | 1.65% | 6.68% | NA |
| Aus | 269 | 21.90% | 0.00% | 2.97% | 75.09% | NA |
| Indica I | 595 | 3.40% | 0.30% | 1.18% | 95.13% | NA |
| Indica II | 465 | 10.10% | 0.20% | 8.60% | 81.08% | NA |
| Indica III | 913 | 3.30% | 0.00% | 3.72% | 92.99% | NA |
| Indica Intermediate | 786 | 9.90% | 0.80% | 4.71% | 84.61% | NA |
| Temperate Japonica | 767 | 89.40% | 6.60% | 0.78% | 3.13% | NA |
| Tropical Japonica | 504 | 32.90% | 54.80% | 1.98% | 10.32% | NA |
| Japonica Intermediate | 241 | 65.60% | 20.30% | 3.73% | 10.37% | NA |
| VI/Aromatic | 96 | 92.70% | 0.00% | 1.04% | 6.25% | NA |
| Intermediate | 90 | 34.40% | 8.90% | 2.22% | 54.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1119397311 | G -> A | LOC_Os11g32830.1 | downstream_gene_variant ; 2608.0bp to feature; MODIFIER | silent_mutation | Average:27.842; most accessible tissue: Callus, score: 56.536 | N | N | N | N |
| vg1119397311 | G -> A | LOC_Os11g32830-LOC_Os11g32840 | intergenic_region ; MODIFIER | silent_mutation | Average:27.842; most accessible tissue: Callus, score: 56.536 | N | N | N | N |
| vg1119397311 | G -> DEL | N | N | silent_mutation | Average:27.842; most accessible tissue: Callus, score: 56.536 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1119397311 | 3.58E-06 | 1.36E-07 | mr1502 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119397311 | NA | 1.77E-06 | mr1502 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119397311 | NA | 1.68E-07 | mr1543 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119397311 | NA | 4.48E-07 | mr1642 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119397311 | NA | 3.04E-28 | mr1699 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119397311 | 5.62E-13 | 4.57E-24 | mr1871 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119397311 | NA | 1.00E-08 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119397311 | 2.67E-07 | 1.24E-22 | mr1042_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119397311 | 1.73E-07 | 2.84E-17 | mr1742_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119397311 | 3.10E-10 | 1.69E-27 | mr1871_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |